Jul 182016
 

Transgender youth are a special population. Because of the relative novelty of treatment at any age much less for youth, data are scarce. A recent review article examining the published data on transgender youth was published. Let’s take a look at what they found.

First, how about prevalence? How many youth self identify as transgender? There are very, very, few studies that get good numbers on this. One study in New Zealand found that 1.2% of secondary school children identified as transgender, and 2.5% weren’t sure about their gender.

As we well know, being a gender and sexual minority can often be associated with health disparities. And this review reports on that too. Identifying as transgender was associated with negative psychological health. Specifically, being bullied, having symptoms of depression, attempting self harm, and attempting suicide were all more common in transgender youth than in cisgender youth. How much of that was because of discrimination and how much was because of gender dysphoria was not explored.

Researchers have also found that being transgender and having autism appear to go together. No one is quite sure why yet. There’s still a lot of research to be done to figure that out.

One interesting difference in the literature stands out to me, though. It appears that transgender men are more likely to self harm and transgender women are more likely to be autistic. Among cisgender people, cis women are more likely to self harm and cis men are more likely to be autistic. There are theories for why that sex difference exists, but there’s little to no agreement. It could be related to social environments, hormones, the environment in the womb, or any number of other factors. But the observation that transgender men and women more resemble their sex than their gender for self harm and autism is worth investigating further.

What about the effects of hormone therapy for transgender youth? Especially puberty suppression, which is the unique factor for their treatment? As a reminder, the treatment of transgender youth is largely based on the Dutch model. At puberty, children go on puberty suppressing drugs. They then go on hormones (and thus begin puberty) at age 16 and are eligible for surgery at age 18. There are efforts to deliver cross-sex hormones earlier, but the Dutch model is the standard that most of the research is based on. A Dutch study found that the psychological health of transgender youth improved after surgery. Their psychological health even equalled that of their cisgender peers! The researchers also found that youth continued to struggle with body image throughout the time they were on puberty suppression only. But their self-image improved with hormone therapy and surgery. None of the children regretted transitioning. And they said that social transition was “easy”.

One challenge to that particular Dutch study is that the Dutch protocol excludes trans youth who have significant psychiatric issues. A young person with unmanaged schizophrenia, severe depression, or other similar issue wouldn’t be allowed to start hormones. So the research was only on relatively psychologically healthy youth to begin with. It’s difficult to say if that had an effect on the study’s results. It’s also difficult to say whether the psychological health of a trans youth is the cause or the result of their dysphoria. A trans youth with depression might well benefit from hormone therapy, after all.

There are multiple questions still unresolved when it comes to treating transgender children. Does puberty suppression have a long term effect on their bones? Are there long-term physical or psychological health effects of early transition? How should children with serious psychological conditions be treated (besides the obvious answer — with compassion)? And on, and on.

The medical and scientific communities are working on answering these questions. But it will take time. And in the mean time — physicians and families do they best they can with what information we have. If you have, or are, a transgender youth please consider participating in a study so we can do even better for children in the future.

Want to read the review for yourself? The abstract is publicly available.

Jun 272016
 

Welcome back to Open Minded Health Promotion! This week is all about how cisgender women who have sex with women, including lesbian and bisexual women, can maximize their health. As a reminder — these are all in addition to health promotion activities that apply to most people, like colon cancer screening at age 50.

Woman-and-woman-icon.svgAll cisgender women who have sex with women should consider…

  • Talk with their physician about their physical and mental health
  • Practice safer sex where possible to prevent pregnancy and sexually transmitted infections. Some sexually transmitted infections can be passed between women. If sexual toys are shared, consider using barriers or cleaning them between uses.
  • If under the age of 26, get the HPV vaccine. This will reduce the chance for cervical, vaginal, anal, and oral cancers.
  • Avoid tobacco, limit alcohol, and limit/avoid other drugs. If you choose to use substances and are unwilling to stop, consider using them in the safest ways possible. For example, consider vaporizing marijuana instead of smoking, or participate in a clean needle program.
  • Maintain a healthy weight. Women who have sex with women are more likely to be overweight than their heterosexual peers. Being overweight is associated with heart disease and a lower quality of life.
  • Exercise regularly. Weight bearing exercise, like walking and running, is best for bone health. But anything that gets your heart rate up and gets you moving is good for your body and mind!
  • Seek help if you’re struggling with self injury, anorexia, or bulimia. These issues are much more common in women than in men, and can be particularly challenging to deal with.
  • Consider taking folic acid supplements if pregnancy is a possibility. Folic acid prevents some birth defects.
  • Discuss their family’s cancer history with their physician.

Your physician may wish to do other tests, including…

  • Cervical cancer screening/Pap smear. All women with a cervix, starting at age 21, should get a pap smear every 3-5 years at minimum. Human papilloma virus (HPV) testing may also be included. More frequent pap smears may be recommended if one comes back positive or abnormal.
  • Pregnancy testing, even if you have not had contact with semen. Emergency situations are where testing is most likely to be urged. Physicians are, to some extent, trained to assume a cisgender woman is pregnant until proven otherwise. If you feel strongly that you do not want to get tested, please discuss this with your physician.
  • BRCA screening to determine your breast cancer risk, if breast cancer runs in your family. They may wish to perform other genetic testing as well, and may refer you to a geneticist.
  • If you’re between the ages of 50 and 74, mammography every other year is recommended. Mammography is a screening test for breast cancer. Breast self exams are no longer recommended.

One note on sexually transmitted infections… some lesbian and bisexual women may feel that they are not at risk for sexually transmitted infections because they don’t have contact with men. This is simply not true. The specific STIs are different, but there are still serious infections that can be spread from cis woman to cis woman. Infections that cis lesbians and bisexual women are at risk for include: chlamydia, herpes, HPV, pubic lice, trichomoniasis, and bacterial vaginosis (Source). Other infections such as gonorrhea, HIV, and syphilis are less likely but could still be spread. Please play safe and seek treatment if you are exposed or having symptoms.

Want more information? You can read more from the CDC, Gay and Lesbian Medical Association, and the United States Preventative Services Task Force.

Nov 022015
 

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 262015
 

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published! This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

Oct 122015
 
Human Papilloma Virus

Human Papilloma Virus

Little is known about reproductive cancer risks among cisgender lesbian and bisexual women. Cancer registries generally don’t ask about sexual orientation. Studies suggest so far that lesbian and bisexual women are less likely to get a pelvic exam and pap smear when it’s recommended. Pap smears help to detect cancer in its earlier, most easily treated and cured stages. Logically, lesbian and bisexual women may be at risk for having more developed (and potentially incurable) cancers. The data confirming that aren’t in yet, but it seems likely.

And now we have HPV vaccines. The human papilloma virus is a major cause of cervical cancer, along with anal cancer, penile cancer, and mouth/throat cancers. Human papilloma virus spreads by skin-to-skin sexual contact regardless of biological sex or gender. Along with pap smears, the HPV vaccine has been a great tool for preventing advanced cervical cancers.

This week I looked at a study of survey data from 15-25 year old women from the National Survey of Family Growth, from 2006-2010. They asked the questions: “Have you heard of the HPV vaccine?” and “Have you received the HPV vaccine?”

The results were rather spectacular. Lesbian, bisexual, and straight women had heard of the HPV vaccine. There was no difference there. However, 28% of straight women, 33% of bisexual women and 8.5% of lesbian women received the HPV vaccine.

That’s 8.5% of lesbians vs 28-33% of non-lesbian women.

Why?? Lesbians are at risk for HPV infection too!

Before looking at what the authors thought, I have some thoughts of my own.

2006, the earliest year this study had data on, isn’t too far off from when I graduated high school. I remember the sex ed class we had. We were lucky to have sex ed at all. It was a one-day class focused on the effectiveness of birth control options, how to put a condom on a banana (or maybe it was a cucumber?), and sexually transmitted diseases that can be passed between men and women in penis-in-vagina sex. There was no discussion of sexually transmitted diseases that are passed between men who have sex with men or women who have sex with women. I remember walking out of the class feeling confused and alone — what STDs were passable between women, and how can women protect themselves and their partners? Were there diseases that women could spread? Was protection warranted? I had no idea.

The study authors discuss similar problems and attributed the difference between lesbian HPV vaccine and bisexual/heterosexual HPV vaccine to misinformation. The idea that lesbian women who have never had sexual contact with men don’t need pap smears or HPV vaccines is old and incorrect, but still persists. I remember when pap smears were recommended starting at first sexual contact with men — if a woman never had sexual contact with a man then she didn’t ever need a pap, right? Wrong!

But it takes time to correct misinformation. As the authors correctly point out, important changes have happened since 2010. HPV vaccine is now recommended for all young people regardless of sex, sexual activity, sexual orientation, or gender identity. It’s not just a vaccine for a sexually transmitted disease — it’s a vaccine against some forms of cancer. Pap smears are now recommended for everyone with a cervix every 3-5 years or so.

So can you be part of the change? Help spread the word about HPV vaccine for *all* people, and pap smears for people cervixes!

The study was published in the Annals of Internal Medicine. The abstract is publicly available.