Nov 162015
 

This week let’s take a break from genetics and ask: “Among transgender people seeking medical treatment, how many want what treatment? Among those who are not seeking out the traditional transition, what are their reasons?” As you might have guessed, a paper from the Netherlands was just online published ahead of print addressing these very questions.

360 people seeking treatment at a specific clinic in the Netherlands were surveyed; 233 (64.7%) of them were assigned male at birth (AMAB; mostly trans feminine) and 127 (35.3%) were assigned female at birth (AFAB; mostly trans masculine). Because this was a survey specifically asking about trans people who may fall outside the gender binary, I’ll stick to the AFAB/AMAB terminology.

The researchers also defined “full” and “partial” transition. For the purposes of this study, “full” transition was either:

  • Antiandrogens + estrogen + orchiectomy + vaginoplasty, for AMAB people
  • Androgens + mastectomy + hysterectomy/oophorectomy + phalloplasty or metoidioplasty, for AFAB people

Variations on these were considered “partial” transition, even if they included more surgeries (such as facial feminization surgery or breast augmentation). By using the terms “full” and “partial”, neither the researchers nor I are trying to imply that one form of transition is any better, desirable, or more “complete” than any other. It’s a historical term, and used here only as a label for one set of treatments that have been considered a “standard” treatment.

So — what did the 360 people want? 10 weren’t sure yet (2.8%). Overall, 253 (70%) wanted “full” treatment. and 97 (27%) wanted “partial” treatment. Of the 97 who wanted a “partial” treatment, 47 cited surgical risks and concerns about the ultimate result, 19 had no genital dysphoria and felt genital surgery wasn’t important for them, 5 felt they were too old, 4 had a non-binary gender identity, 1 was afraid of social rejection, 1 wanted to remain fertile, 1 wanted to go outside the country for surgery, and the others declined to answer.

If you look at the data differently, AFAB and AMAB people wanted different things. Among the 225 AMAB people who knew what they wanted, 180 (77%) wanted “full” treatment. Only 45 (19%) wanted a different treatment. 12 wanted hormones only, another 12 wanted hormones and breast augmentation, and another 10 wanted hormones and breast augmentation and facial feminization surgery.

AFAB people were less likely to want “full” treatment — only 73 of 125 (57%) wanted “full” treatment. Of those, 35 wanted phalloplasty, 12 wanted metoidioplasty, and 26 were uncertain. 52 of 125 (41%) wanted “partial” treatment, with the majority (31) wanting androgens, mastectomy and hysterectomy and 18 wanting androgens and mastectomy without hysterectomy.

That’s quite a difference between AMAB and AFAB people — 77% vs 57% wanting “full” treatment. When the reasons were compared, AFAB people were most likely to be concerned about the risks and results of surgery. AMAB people, on the other hands, were more likely to report feeling that genital surgery was unnecessary.

Of course, this was just one survey within one culture. However, it’s interesting food for thought and gives one set of ballpark figures for who wants what treatment.

Want to read the study for yourself? The abstract is publicly available!

Nov 022015
 

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Aug 102015
 

Rainbow ribbon for LGBT+ cancer awarenessGender and sexual minority health isn’t just about HIV/AIDS, sexually transmitted infections, and mental health. It’s also about cancers, and our exposures to risk factors for cancers. Why? Because everyone can get cancer, and we all need both preventative and therapeutic health care.

Cancer is not just one disease, which is why it’s been so difficult to “cure”. Cancer is when a cell mutates and grows out of control. The cells begin to invade other tissues, and can spread throughout the body. Any cell can become cancerous. And different cancers are caused by different things and have different treatments.

A recent paper, published online ahead of print, looked at the data surrounding lesbian, gay, bisexual and transgender/transsexual (LGBT) populations and cancers. They specifically looked at cancers which may be more common in LGBT communities: anal, breast, cervical, colon/rectal, endometrial, lung, and prostate cancers.

Why might these cancers be more common in LGBT communities? Perhaps because of higher levels of risk factors like obesity, smoking, and certain infections. Or perhaps because of lack of preventative health care.

But what do the data say? What data do we even have? So far it looks like we don’t have much information. Most studies about cancers don’t ask about sexual orientation or gender identity. But let’s take the data one cancer type at a time, just as the paper did…

Anal cancer is a rare cancer of the anus. It’s primarily associated with HIV infection and HPV infection. Men who have sex with men, because they are at high risk for HIV and HPV infections, are at higher risk for anal cancer. The risks for women and transgender people are unknown. The best prevention for anal cancer is the HPV vaccine and consistent use of condoms to prevent HPV and HIV infections. Screening, to catch cancers in their most treatable state, can be done through the anal pap test. However there are no guidelines for the anal pap test and its value as a screening tool is uncertain. Treatment for anal cancer can impact not only general quality of life for survivors but sexual quality of life for men who have sex with men. The effects on sexual quality of life may be under appreciated by physicians.

Breast cancer is among the most frequently diagnosed cancers in women. Unlike with anal cancer, there are no obvious risk factors beyond being a cisgender woman. There are no data on how rates of breast cancer differ between heterosexual, bisexual and lesbian women. It is thought that bisexual/lesbian women may be at higher risk of breast cancer because of high rates of smoking, alcohol use, and obesity. Lesbian/bisexual women are also less likely to carry a pregnancy. However, it’s not known if those risk factors are actually associated with higher rates of disease. There are no data on cis or trans male breast cancer. Trans women were thought to potentially be at higher risk because of the hormones they take, but data so far seem to indicate that they’re at low risk. When it comes to screening, the best screenings so far are clinical breast exams and mammography. Women who have sex with women are less likely to receive either. Once they survive a breast cancer, women who have sex with women may be at risk for sexual side effects more than heterosexual women.

Cervical cancer is a cancer that exclusively affects cisgender women, pre-op trans men and others who have a cervix. There are no data describing how the risk for cervical cancer may be different for bisexual/lesbian women and trans men. The biggest risk for cervical cancer is HPV infection. The best prevention of cervical cancer includes the HPV vaccine and the use of barriers to prevent HPV infection. For screening, pelvic exam with pap smear at a regular interval is recommended. Women who have sex with women are less likely to receive the vaccine and less likely to receive regular screenings. Anecdotal evidence suggests that the same is true for trans men. This would leave both bisexual/lesbian women and trans men at higher risk for cervical cancer, and higher risk that if there is cancer it will be discovered at a later stage. No studies have been performed examining how women who have sex with women and trans men fare after a cervical cancer diagnosis.

Colon cancer is the third most common cancer in both men and women. Preliminary studies indicate that lesbian, gay, and bisexual cisgender people are not being diagnosed with colon cancer more frequently than heterosexual people are. There are no data on trans people. However, LGB people are more likely to have risk factors like obesity, smoking, and alcohol use. On the whole, they are also less likely to receive screenings for colon cancer. The exception is gay and bisexual men, who receive colonoscopy and sigmoidoscopy more often than heterosexual men (the authors theorize that this may be because colonoscopy and sigmoidoscopy are used to diagnose difficulties with receptive anal sex). No studies have compared side effects in LGBT survivors. However, clinicians should advise men who have receptive anal sex that treatment may impact their sexual life.

Endometrial cancer is a cancer of the lining of the uterus, which can affect any individual with that lining. There are no data on lesbian, bisexual, or transgender populations nor are there recommendations for prevention and screening for endometrial cancer. Survivor outcomes are similarly murky. However the authors note that lesbian and bisexual women, because of stigma, may seek medical care later than heterosexual women. The authors advocate for a welcoming LGBT environment for patients to facilitate early detection and treatment.

Lung cancer is the leading cause of cancer death worldwide and is primarily caused by tobacco smoke. There are no direct studies of lung cancer in LGBT populations, but LGBT people are far more likely than heterosexual/cisgender people to smoke. LGBT people, as a whole, are thus at higher risk for lung cancer. While an annual screening (via low-dose CT scan) is recommended for some long term smokers, the guidelines were not intended for LGBT patients and may not be appropriate. Outcomes and side effects are unknown for LGBT people.

Prostate cancer is a cancer that exclusively affects cisgender men and transgender women (regardless of surgical status — the prostate is not removed in surgery). HIV+ men may be at lower risk for prostate cancer, though that may be an artifact of testing. The risk of prostate cancer for trans women is unknown, but is not zero. The screening test for prostate cancer, prostate specific antigen (PSA), is of limited value, but it appears that there are no differences in screening based on sexual orientation. Treatment for prostate cancer often has sexual and bowel side effects which may affect men who have sex with men differently (particularly men who prefer receptive anal sex).

Astute readers may have noticed a trend: There are not enough data. This is a huge problem in gender and sexual minority health. We just do not know enough, particularly about topics other than HIV. While some research is going on now to try to tackle these issues, it will be a while before those results come out and get validated.

So in the mean time, what is an LGBT+ person, worried about cancer, to do? You have options! You can…

  • Find a medical provider whom you feel safe and comfortable with, and make sure you come out to them. Ask them about screening schedules for you, given your own set of risk factors. Screenings will not prevent cancer, but they will allow your physician to detect cancer in its earliest, most curable stages and could save your life.
  • Exercise, achieve/maintain as healthy a weight as you can, and eat a varied diet. All of these things will help reduce your risks.
  • Quit smoking, if you currently use tobacco. Don’t start to use tobacco if you currently don’t. All forms of tobacco cause cancer, including chew and snuff.
  • Limit alcohol consumption. Drinking a lot is associated with higher rates of some cancers.
  • Be HPV-aware, and get vaccinated if you can. Use barriers in sexual encounters to prevent both HPV and HIV infection.
  • Be as familiar with your body as you can, so that you can detect changes and notify your physician.

Want to read the study for yourself? It’s publicly available!

Jul 132015
 
CDC_edamame

Soybeans, a common source of phytoestrogens

Have you heard that some herbs and foods contain chemicals called “phytoestrogens” that work like estrogen in the body? Ever seen products being sold over the counter advertised to “feminize naturally” or “prevent hot flashes during menopause”? Or read conversations online about using over the counter products to feminize instead of prescribed hormones? Did you stop and wonder if there was truth to the claims? Let’s do a quick overview and do some debunking!

What are phytoestrogens?

Phytoestrogens are estrogen-like chemicals made by plants. Just like how the tobacco plant makes nicotine to defend itself against insects, phytoestrogens are thought to have a protective effect for the plant. One of the most commonly known phytoestrogen is soy isoflavone, which is found in soy beans and soy products. However other plants produce this compounds too. Red clover is another commonly found herb in herbal products.

As a side note: There are three forms of estrogen in the human body that are commonly talked about. Estradiol is the strongest. The type of estrogen used in modern-day hormone therapy is estradiol. So when you see estradiol in the rest of the article, feel free to mentally substitute “estrogen”.

Is it possible that phytoestrogens can feminize?

All things are possible.

First, let’s talk about dose. Phytoestrogens are found in very small doses in foods, or in slightly higher doses in supplements.

Medical transition requires high doses of hormones. A typical dose of estrogen today, when combined with an anti-androgen is around 4mg a day. Before antiandrogens were introduced, doses equivalent to 12mg of estradiol a day were used*. That’s a lot of hormone.

Phytoestrogen products do not come with an anti-androgen. Is it possible that they’re reaching the equivalent dose of 12mg of estradiol a day? Doses found in Canadian products ranged from 1mg to 35mg of phytoestrogens. So if phytoestrogens are equal in strength to estradiol, perhaps.

But that’s a big assumption. The body absorbs different drugs from the digestive tract in different amounts. Then that drug goes through the liver, where some portion may be activated or deactivated. And then it has to circulate around in the blood stream, find its way into the tissues of the body, and find its target. Pharmaceutical drugs have all these factors measured and calculated, so that the dose you’re given should ensure a certain dose is delivered into your tissues in the end. These herbs have not been studied in that way — so until more research is done, it’s difficult to know how much actually gets to the tissues. And it’s known that phytoestrogens bind to estrogen receptors only weakly, so they’re likely to have a weaker effect than estradiol.

In the doses that are being taken, do they have any effect?

As far as I can tell from the evidence, no. Phytoestrogens are marketed to cis women for relief from hot flashes. A study from 2003 published in JAMA found that they do not provide significant relief from hot flashes. Most of the clinical evidence that I’ve seen agrees with that study.

In cis men, phytoestrogens do not affect testosterone levels and does not feminize.

Worse, one study found that among cis women, those who were taking phytoestrogens had lower levels of estrogen in their blood than women who were not taking phytoestrogens.

While in theory phytoestrogens may possibly help with feminization, I see no medical evidence to suggest that they actually do.

Do phytoestrogens provide a consistent dose? Do the pills contain what they say they contain? Is there any regulation?

No. The dose ranges from company to company, pill to pill, season to season. Companies all have their own special formulations with different sources and types of phytoestrogens.

In the United States, supplements are not regulated by the FDA like drugs are. They’re in a special category. There are no independent checks to make sure the supplement is safe before it goes to market. There are no guarantees that the bottle actually has what it says it has. A Canadian study found wide variation in the amounts of phytoestrogens in various products.

Summary

Phytoestrogen supplements may seem to offer an accessible, easy way to feminize. However, there’s little to no evidence behind their use. And since they’re supplements, you’re never sure of what you’ll be getting. If you want to eat foods that are high in phytoestrogen, they’re not likely to do you harm. But from what I can tell of the literature, you’re better off saving that $20 to pay for an estrogen prescription.

If you’re having difficulty finding a physician who’s will prescribe hormone therapy, I urge you to call your local transgender or LGBT center, or visit the WPATH or GLMA website for provider listings.

*: These formulations were often from conjugated estrogens, which use a slightly different dosing. Doses of conjugated estrogens ranged from 7.5 to 10mg/day, and .625mg of conjugated estrogens is roughly equivalent to 1mg of oral estradiol. My figure of 12 mg of estrogen was using the “low” dosage of 7.5mg.

Nov 072013
 

Skin - CC BY-NC-ND 2.0 - flickr user zorro-the-catSummary: A Belgian study of trans men found that type of testosterone given does not affect hair growth, acne, or balding, and characterized further the skin changes that happen with testosterone therapy.

This was a study of the skin quality of trans men, performed in Belgium. Why study this topic at all? Because some of the effects of hormone therapy for trans men are skin-related. The skin may get oilier, acne may increase, hair grows in places it didn’t before and gets thicker and rougher, and for some men they start to have male-pattern baldness or a receding hair line. These effects have also been seen in cisgender women with polycystic ovarian syndrome, where they have high levels of testosterone. Turns out, though, that it’s not so much testosterone itself that causes these effects. It’s dihydrotestosterone (DHT), which is made from testosterone. You can think of DHT like a super-powered version of T. This is why medications like finasteride can sometimes prevent hair loss, by blocking the conversion of T to DHT.

The WPATH Standards of Care estimates the following timeline for various skin-related changes from starting testosterone as such:

  • Acne increases in the first 1-6 months, peaking around 1-2 years on T
  • Body hair growth starts in 3-6 months, peaking around 3-5 years
  • Hair loss is highly variable, but would be expected to start after at least a year T.

So what about this study? What exactly were they looking at? This study looked at a long-acting form of testosterone which hasn’t been used in previous studies of trans men skin. Classically, hormone therapy for trans men is a weekly or biweekly intramuscular injection of testosterone cypionate or testosterone ethanate. Which testosterone you receive depends on the country (cypionate’s more common in the US), seed/nut allergies, cost, and personal/physician preferences. This study looked instead at testosterone undecanoate, which is given every three months. This study then asks two questions:

  1. Is there any difference in the effects of skin between testosterone undecanoate and the more common 1-2 week injections?
  2. What effects on skin can we see from long-term testosterone use?

To answer those questions the researchers did both a longitudinal and cross-sectional study. Remember, a longitudinal study is one where a a group of people is “followed” over a period of time. It provides a good picture of how things change over that time period, but can be expensive. A cross-sectional study examines people only once. It provides a lot less data but is cheaper.

For the longitudinal study they focused on testosterone undecanoate. They followed a group of 20 trans men over the course of their first year on testosterone (undecanoate), asking them back to do bloodwork and questionnaires every 3 months. For the cross-sectional study, they examined 50 trans men only once. These men were all post-hysterectomy/oophorectomy and had been on testosterone an average of 9.9 years (3.2 – 27.5 years range). 35 of them were on a mix of testosterone esters every 2-3 weeks, 7 were on testosterone undecanoate, and 8 were on topical cremes. Exclusion criteria were the usual, and quite reasonable: excluding those with endocrine problems, prolonged use of corticosteroids, and the like.

What did the researchers look at specifically?

  • Degree of hair growth on the lips, chin, chest, upper back, tailbone area, abdomen, arm, and inner thigh (“Ferriman and Gallwey” method)
  • Satisfaction with their hair growth patterns
  • Evaluation of acne, including the back/neck areas
  • Quantity of sebum production. Sebum is oil that skin produces.
  • Bloodwork, including: sex hormone-binding globulin, luteinizing hormone, follicle-stimulating hormone, estrogen, and testosterone

Results? Well let’s look at this one subject at a time…

  • Hair growth? For the longitudinal group, it appeared to increase most dramatically between 3-6 months. However hair growth appeared to continue to increase past that point. The type of testosterone did not appear to be associated with different levels of hair or satisfaction in hair amounts. There was a lot of variation in the fuzziness of the participants with some men not increasing their fuzziness at all.
  • Male pattern baldness? One person in the longitudinal group started balding in his first year. Among those on testosterone for more than a year, roughly a third has severe balding, a third had mild/minimal balding, and a third had no balding at all. There was not association between the type of testosterone and balding, though the older the man was the more likely it was he would bald.
  • Acne? For the longitudinal group, it was worst at 6 months but rapidly improved after that. At that 6 month mark, 82% of the men had facial acne. During the first year, roughly half of the men used various acne control products. For those in the cross-sectional group, roughly 1/3 did not have acne. 2/3rds had minor acne. 2/3rds of the group also had no acne scarring.
  • Sebum production? Was evaluated only in the cross-sectional group, and was not elevated. It also wasn’t associated with acne, or hormone therapy type/duration.
  • Bloodwork and hormone levels? No associations were found between any sex hormone levels and any of the skin factors measured (hair growth, baldness, acne, sebum)…. with one exception. In the cross-sectional group, estrogen levels were associated with hair growth. The authors are uncertain what that result might mean, and it may well be a fluke. Further research will have to find out.

But what does it all mean?! Well remember the original two things the researchers were investigating? Scroll up if you need to. Basically, it means that there doesn’t appear to be a difference in skin effects between the different types of testosterone therapy. And a trans man starting on testosterone can expect mild acne which peaks around the 6 month mark. Hair growth will accelerate the fastest during the 3-6 month period, but will continue afterward. But if he’s going to go bald, it likely won’t be in that first year.

Study limitations? The authors were pretty honest about the limitations of their measures. Some were subjective (e.g., the Ferriman and Gallwey method used for hair growth) and did not assess all areas that may change (e.g., buttocks and hair growth). They also point out the usual limitations inherit to the cross-sectional part of their study – it’s very hard to determine causes. I would also add the limitations in their sample size (relatively small), ethnicity/race (not reported, but nearly all participants were from Belgium). I also did not see them account for smoking tobacco in their study, though they did report the smoking rates (25-28%) of their groups. A number of potential variables were not reported on, such as hygiene or familial hairiness.

However I don’t see any glaring errors in this study, and it seems to have been respectfully done. Its language usage is certainly more respectful than many studies I’ve read about trans health.

This article was published in the Journal of Sexual Medicine. Its abstract is publicly available.