Aug 152016

Welcome back to Open Minded Health Promotion! This week we’re looking at health promotion for transgender women and individuals assigned male at birth. Depending on your history some of these tips will apply more or less to you.

TransgenderPlease remember that these are specific aspects of health in addition to the standard recommendations for everyone (e.g., colonoscopy at age 50). Based on your health and your history, your doctor may have different recommendations for you. Listen to them.

All transgender women should consider…
  • Talk with their doctor about their physical and mental health
  • Practice safer sex where possible. Sexually transmitted infections can be prevented with condoms, dental dams, and other barriers. If you share sexual toys consider using condoms/barriers or cleaning them between uses.
  • Consider using birth control methods if applicable. Hormone therapy is not birth control. Orchiectomy and vasectomy are permanent birth control options. You can still have vaginoplasty after those procedures if you desire. Alternatively, you can use condoms and asking your partner to use hormonal birth control.
  • Store sperm before starting hormone therapy if you want genetic children. Estrogen and anti-androgens definitely affect fertility. You may never be able to have genetic children after hormone therapy.
  • If you’re under the age of 26, get the HPV vaccine. This will reduce the chance for anal, oral, and penile cancers. Theoretically it may also reduce your risk for (neo) vaginal cancers.
  • Protect yourself from HIV. Consider using pre-exposure prophylaxis in addition to condoms in sexual encounters that are higher risk. Avoid selling sex if you can.
  • Avoid tobacco, limit alcohol, and limit/avoid other drugs. If you choose to use substances and are unwilling to stop, consider strategies to limit your risk. For example, consider participating in a clean needle program. Vaporize instead of smoke. And use as little of the drug as you can.
  • Maintain a healthy weight. While being heavy sometimes helps to hide unwanted physical features, it’s also associated with heart disease and a lower quality of life.
  • Limit high-potassium foods while on spironolactone if possible.
  • Exercise regularly. Anything that gets your heart rate up and gets you moving is good for your body and mind! Weight bearing exercise, like walking and running, is best for bone health. If you’re looking to avoid “bulking” up your muscles, cardio exercises are probably your best bet. Staying physically active is especially important if you have a family or personal history of cardiovascular disease. Another great tip to control your weight is using the best diet pills in the market you can easily buy at the Cleve Scene website.
  • Avoid buying hormones from online stores or on the street. There is no guarantee that you’re getting what you think you’re getting. Even if you do there is no guarantee that the drug was created in a safe lab or was stored properly. Drugs made in the US are guaranteed to contain what they said they do. They are also made in clean facilities and stored correctly so they don’t degrade. Additionally buying hormones online is far more expensive than getting a prescription and going to a pharmacy (especially with discount plans many pharmacies provide). Thus if you can get a prescription, doing so is less risky and far cheaper. For more information, see the FDA.
  • Do not inject silicone. It not only disfigures, it kills. Additionally unsafe needle practices risk spreading HIV and Hepatitis C.
  • If you’ve had genital surgery and you’re all healed from surgery, remember to continue to dilate and take care of your vagina. Keep in touch with your doctor as you need to. Call your surgeon if something specific to the surgery is concerning. Continue to practice safe sex. And enjoy!
Your doctor may wish to do other tests, including…
  • Prostate cancer screening. Vaginoplasty does not remove the prostate. Testosterone is one of the major drivers of prostate cancer. Therefore trans women are at a lower risk for prostate cancer. However, that risk may still exist. Your doctor may recommend a blood test or a digital rectal exam. They should discuss with you the benefits and potential harms of screening.
  • Breast examination for potential detection of breast cancer. We really don’t know yet how much risk trans women are at for breast cancer. Current data suggest that trans women are at low risk. However your doctor may wish to perform a breast examination as part of a physical exam. The goal of the exam is to detect lumps and/or bumps that may need further investigation. They may also teach you how to do a self-exam.
  • Mammography. Again, this is for potential detection of breast cancer. Some doctors recommend following the typical recommendations for cis women. However even those recommendations vary depending on the organization recommending them. Most recommendations include a mammography every 1-2 years starting around age 50. Thus once you turn 50, consider talking with your doctor about the need for mammography.
  • Vaginal examination. For post-op trans women, the vagina is either (penile) skin or intestine. Either way, it can still develop cancer. Some doctors recommend a visual inspection of the vagina to detect such cancers. Others do not.
  • Testicular/penile examination. As long as you have a penis and testes, your doctor may recommend examination. They look for potential cancer as well as hernias (the “turn your head and cough” test).

And most importantly: Take care of your mental health. We lose far too many people every year to suicide. Perhaps worse, far more struggle with depression and anxiety. Do what you need to do to take care of you. If your normal strategies aren’t working then reach out. There is help.

Want more information? You can read more from UCSF’s Primary Care Protocols and the Gay and Lesbian Medical Association.

Jul 182016

Transgender youth are a special population. Because of the relative novelty of treatment at any age much less for youth, data are scarce. A recent review article examining the published data on transgender youth was published. Let’s take a look at what they found.

First, how about prevalence? How many youth self identify as transgender? There are very, very, few studies that get good numbers on this. One study in New Zealand found that 1.2% of secondary school children identified as transgender, and 2.5% weren’t sure about their gender.

As we well know, being a gender and sexual minority can often be associated with health disparities. And this review reports on that too. Identifying as transgender was associated with negative psychological health. Specifically, being bullied, having symptoms of depression, attempting self harm, and attempting suicide were all more common in transgender youth than in cisgender youth. How much of that was because of discrimination and how much was because of gender dysphoria was not explored.

Researchers have also found that being transgender and having autism appear to go together. No one is quite sure why yet. There’s still a lot of research to be done to figure that out.

One interesting difference in the literature stands out to me, though. It appears that transgender men are more likely to self harm and transgender women are more likely to be autistic. Among cisgender people, cis women are more likely to self harm and cis men are more likely to be autistic. There are theories for why that sex difference exists, but there’s little to no agreement. It could be related to social environments, hormones, the environment in the womb, or any number of other factors. But the observation that transgender men and women more resemble their sex than their gender for self harm and autism is worth investigating further.

What about the effects of hormone therapy for transgender youth? Especially puberty suppression, which is the unique factor for their treatment? As a reminder, the treatment of transgender youth is largely based on the Dutch model. At puberty, children go on puberty suppressing drugs. They then go on hormones (and thus begin puberty) at age 16 and are eligible for surgery at age 18. There are efforts to deliver cross-sex hormones earlier, but the Dutch model is the standard that most of the research is based on. A Dutch study found that the psychological health of transgender youth improved after surgery. Their psychological health even equalled that of their cisgender peers! The researchers also found that youth continued to struggle with body image throughout the time they were on puberty suppression only. But their self-image improved with hormone therapy and surgery. None of the children regretted transitioning. And they said that social transition was “easy”.

One challenge to that particular Dutch study is that the Dutch protocol excludes trans youth who have significant psychiatric issues. A young person with unmanaged schizophrenia, severe depression, or other similar issue wouldn’t be allowed to start hormones. So the research was only on relatively psychologically healthy youth to begin with. It’s difficult to say if that had an effect on the study’s results. It’s also difficult to say whether the psychological health of a trans youth is the cause or the result of their dysphoria. A trans youth with depression might well benefit from hormone therapy, after all.

There are multiple questions still unresolved when it comes to treating transgender children. Does puberty suppression have a long term effect on their bones? Are there long-term physical or psychological health effects of early transition? How should children with serious psychological conditions be treated (besides the obvious answer — with compassion)? And on, and on.

The medical and scientific communities are working on answering these questions. But it will take time. And in the mean time — physicians and families do they best they can with what information we have. If you have, or are, a transgender youth please consider participating in a study so we can do even better for children in the future.

Want to read the review for yourself? The abstract is publicly available.

Nov 022015

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 052015

480px-RGB_LED_Rainbow_from_7th_symmetry_cylindrical_gratingI’ve been saying for years now that the phrase “LGBT community” is insufficient when it comes to health. It’s not one community — it is multiple communities. The social issues and health issues that a gay transgender man faces every day are different from the issues a bisexual cisgender woman faces every day. There are some similarities and grouping the communities together has been politically useful. But it should never be forgotten that L, G, B, and T all face different types of health concerns and have different civil rights battles to face.

A study came out in August that has to be one of my favorites this year. Researchers in Georgia surveyed over three thousand lesbian, gay, bisexual, pansexual, transgender, gender non-conforming, and queer people. They asked about health behaviors of all kinds. And then they did statistical analysis, comparing the various genders (cis male, cis female, trans male, trans female, genderqueer) and sexual orientations (lesbian, gay, bisexual, pansexual, queer, straight). Let’s look at what they found!

  • Diet and exercise: The researchers asked about fatty foods, eating while not hungry, quantity of vegetables and fruits eaten, and about hours and types of exercise. Transgender women had the least healthy diet of all genders. As a group, they were less likely to eat many fruits and vegetables, and more likely to drink sugared drinks and eat when they weren’t hungry. Both cisgender and transgender men were also less likely to eat many vegetables compared with other groups. Genderqueer people and gay cisgender men were most likely to exercise.
  • Substance use: The researchers asked about smoking tobacco and alcohol consumption. Cisgender men were the most likely to drink alcohol, binge drink, and to drink even when they didn’t want to. Participants who identified as queer were also more likely to drink. When it came to tobacco, transgender men and straight participants were the most likely to smoke.
  • Motor vehicle risk: The researchers asked about seatbelt use, speeding, and texting while driving. No clear differences for speeding were noted. Transgender men and straight participants were most likely to drive without a seatbelt. Texting while driving varied considerably; gay and lesbian drivers were most likely to text while driving.
  • Sexual behaviors: The researchers asked about frequency of unprotected sex and sex while intoxicated. Gay men were least likely to have unprotected sex while lesbian women were most likely to have unprotected sex. When it came to sex while intoxicated, only the bisexual participants stood out as being most likely among the groups to have sex while intoxicated.
  • Violence: The researchers asked about self harm and expressing anger at others. Overall rates of interpersonal anger were very low. Transgender men and pansexual people were most likely to self harm.
  • Medical risk taking: The researchers asked about delaying medical care and not following physician advice. Transgender women were least likely to seek care; 1/3 reported that they regularly delayed seeking medical care. Both transgender women and transgender men were more likely to not follow medical advice when it was given. Bisexual people were also more likely to delay seeking medical care compared to lesbian and gay participants.

That’s a mouthful, right? There are a lot of details I left out of this summary and it still threatens to be overwhelming with detail. So how we can break this down even more simply? By talking about the conclusions.

The researchers go into some possible causes for all these different results. Maybe gay men are safer about sex because of HIV risk. Maybe transgender men eat few vegetables because of cultural expectations that “men eat lots of meat and not many vegetables.” Maybe gay and lesbian people text more while driving because of the lack of community-specific messages.

Maybe. And they’re all good thoughts.

I tend to look forward more to what we can do with these data. I’m pretty happy with this study — it’s one of the broadest I’ve seen for inclusion. Few health-oriented pieces of research include pansexual and genderqueer individuals.

It’s important to remember that these results are at the group level. Any individual person who is a gender/sexual minority will have their own health behaviors and risks. They should be evaluated and treated as individuals. From a public health perspective though, this research brings valuable data. Only by knowing what each group faces can prevention, screening, and treatment campaigns be created. Only by knowing, for example, that transgender and bisexual people avoid seeking medical care can we then examine “why?” and act to remove the barriers so that appropriate, respectful medical care is available.

So — can we change the conversation? Instead of talking about “the LGBT community”, let’s talk about “the LGBT communities”. Or, even better, “gender and sexual minority communities” — removing the alphabet soup and expanding the definitions at the same time. This research is only the tip of the iceberg. We have so much more to explore.

The paper is published online ahead of print. The abstract is publicly available.

Jan 042015

8787343055_a2a6eb06bf_mIt’s a new year here at Open Minded Health. I hope you all had a safe, fabulous, and fun new years celebration. Here at OMH it’s time for the yearly questions and answers post.

For the unfamiliar — once a year I take a deep look at all the search queries that bring people here. Often, they’re questions that I didn’t completely answer or that need answering. So in case anyone else has these questions — there are answers here now that Google can find. The questions are anonymous and I reword them to further anonymize them.

This year is all questions about transgender health issues. There’s been a lot published and a lot in the news about trans health issues lately. This next year I’ll try to find other articles to post about too, though. 🙂


What are the healthier estrogens that a transgender woman can take?

In order from least risk to most risk: estrogen patch, estrogen injection sublingual/oral estradiol, oral ethinyl estradiol, oral premarin.

But note that that’s an incomplete picture. The estrogen patch isn’t the best for initial transition and is very expensive. Injectable estrogen means sticking yourself with a needle every 1-2 weeks and needing a special letter to fly with medications. By far the cheapest of these options is oral estradiol.

Ethinyl estradiol is the form of estrogen used in birth control. Premarin is conjugated equine estrogens, meaning they’re the estrogens from a pregnant horse. Neither should be the first choice for transition. They’re both higher risk than estradiol.

For transgender women, how long does it take to see the benefits of taking spironolactone?

The rule of thumb is 3 months before changes on hormone therapy.

Where is the incision placed in an orchiectomy for transgender women?

That depends on the surgeon. But I’m know you can find images and personal stories on /r/transhealth and transbucket.

Does a trans man have to stop taking hormones to give birth?

Yes. Trans men and others who can become pregnant who are taking testosterone must stop testosterone treatment before becoming pregnant. Testosterone can cross the placenta and cause serious problems for the fetus. Once the child is delivered and no longer breast feeding testosterone can be resumed.

Once you’re on female hormones, how long does it take to get hair down to your shoulders?

My understanding is that the speed that hair grows doesn’t change. It grows at roughly 1/2 an inch a month. Expect growing it out to shoulder length to take 2-3 years.

As a trans woman on estrogen, are there foods I should avoid?

If you’re on estrogen only, there are no foods you should avoid. Instead eat a healthy varied diet.

If you’re on spironolactone you may need to avoid foods that are high in potassium. Potato skins, sweet potatoes, bananas, and sports supplements are foods you may need to limit or avoid. Ask your physician if you need to avoid these foods.

Is there a special diet that can help me transition?

In general, no. Any effect that food may have is, in general, too subtle to make a difference. The possible exception is foods that are very high in phytoestrogens — like soy. Phytoestrogens are chemicals in plants that act a little like estrogen in the body. There are a few case reports in the medical literature of people developing breasts when they eat a lot (and I do mean a lot) of soy. But they’re unusual. Ask your physician before you make radical changes in your diet. In general — just eat a healthy, varied diet.

I’m a trans guy taking testosterone and having shortness of breath. Do I need to worry?

See a physician as soon as you can. Shortness of breath may be a sign of something serious. Taking testosterone raises your risk for polycythemia (too many red blood cells in the blood), which can manifest as shortness of breath.

How often do trans women get injections of estrogen?

Most women have their injection every week to two weeks.

Can I still masturbate while I’m on estrogen?

Yes. Many trans women have difficulty getting or maintaining an erection though.

Can I get a vaginoplasty before coming out as transgender or transitioning?

Generally speaking, no. Surgeons follow the WPATH standards of care which require hormone therapy and letters of recommendation from physicians and therapists before vaginoplasty.

Are there risks to having deep penetrative sex if you’re a trans woman?

I’m assuming you’re referring to vaginal sex post-vaginoplasty. The vagina after a vaginoplasty is not as stretchy or as sturdy as most cis vaginas. It’s possible to cause some tearing if the sex is vigorous or if there are sharp edges (e.g., a piercing or rough fingernails).

Things you can do that might help prevent injury: Make sure you’re well healed after surgery. Dilate regularly as recommended by your surgeon. Use lots of lubrication, and try to go gently at first. Topical estrogen creams may also be helpful for lubrication and flexibility.

Is it safe to be on trans hormone therapy if you have a high red blood count?

Depends. If you’re a trans man looking for testosterone, you may need treatment first to control the high red blood cell count. Testosterone encourages the body to make more red blood cells, which would make the problem worse.

What kinds of injection-free hormone therapy are available to trans men?

Topical testosterone is available for trans men. It’s a slower transition and it’s expensive, but it exists and it works. Oral testosterone should never be used because of the risk of liver damage.

What can cause cloudy vision in trans women on hormone therapy?

Seek medical care. It could be unrelated, but changes to vision are not a good sign.


And that’s it for this year! Next week we’ll be back to normal posts. 🙂