Jun 272016
 

Welcome back to Open Minded Health Promotion! This week is all about how cisgender women who have sex with women, including lesbian and bisexual women, can maximize their health. As a reminder — these are all in addition to health promotion activities that apply to most people, like colon cancer screening at age 50.

Woman-and-woman-icon.svgAll cisgender women who have sex with women should consider…

  • Talk with their physician about their physical and mental health
  • Practice safer sex where possible to prevent pregnancy and sexually transmitted infections. Some sexually transmitted infections can be passed between women. If sexual toys are shared, consider using barriers or cleaning them between uses.
  • If under the age of 26, get the HPV vaccine. This will reduce the chance for cervical, vaginal, anal, and oral cancers.
  • Avoid tobacco, limit alcohol, and limit/avoid other drugs. If you choose to use substances and are unwilling to stop, consider using them in the safest ways possible. For example, consider vaporizing marijuana instead of smoking, or participate in a clean needle program.
  • Maintain a healthy weight. Women who have sex with women are more likely to be overweight than their heterosexual peers. Being overweight is associated with heart disease and a lower quality of life.
  • Exercise regularly. Weight bearing exercise, like walking and running, is best for bone health. But anything that gets your heart rate up and gets you moving is good for your body and mind!
  • Seek help if you’re struggling with self injury, anorexia, or bulimia. These issues are much more common in women than in men, and can be particularly challenging to deal with.
  • Consider taking folic acid supplements if pregnancy is a possibility. Folic acid prevents some birth defects.
  • Discuss their family’s cancer history with their physician.

Your physician may wish to do other tests, including…

  • Cervical cancer screening/Pap smear. All women with a cervix, starting at age 21, should get a pap smear every 3-5 years at minimum. Human papilloma virus (HPV) testing may also be included. More frequent pap smears may be recommended if one comes back positive or abnormal.
  • Pregnancy testing, even if you have not had contact with semen. Emergency situations are where testing is most likely to be urged. Physicians are, to some extent, trained to assume a cisgender woman is pregnant until proven otherwise. If you feel strongly that you do not want to get tested, please discuss this with your physician.
  • BRCA screening to determine your breast cancer risk, if breast cancer runs in your family. They may wish to perform other genetic testing as well, and may refer you to a geneticist.
  • If you’re between the ages of 50 and 74, mammography every other year is recommended. Mammography is a screening test for breast cancer. Breast self exams are no longer recommended.

One note on sexually transmitted infections… some lesbian and bisexual women may feel that they are not at risk for sexually transmitted infections because they don’t have contact with men. This is simply not true. The specific STIs are different, but there are still serious infections that can be spread from cis woman to cis woman. Infections that cis lesbians and bisexual women are at risk for include: chlamydia, herpes, HPV, pubic lice, trichomoniasis, and bacterial vaginosis (Source). Other infections such as gonorrhea, HIV, and syphilis are less likely but could still be spread. Please play safe and seek treatment if you are exposed or having symptoms.

Want more information? You can read more from the CDC, Gay and Lesbian Medical Association, and the United States Preventative Services Task Force.

Apr 052016
 

Readers,

Open Minded Health is temporarily going to a biweekly post schedule. That is, posts will go from once a week to once every two weeks.

This is for a few reasons. My second year of medical school is coming to an end. I begin prepping for the first, and biggest, of the board exams next week. And I’ll be going into my clinical years in June. The clinical year is one of the busiest years in medical education, only surpassed by residency (the “internship” of medicine).

Going to a biweekly update schedule means updates can still come at regular intervals. I will do my best to make the posts more in depth so the wait is worth it.

I’m also working on a full update to Trans 101. I’ll let you all know when that’s done.

Thank you for continuing to read Open Minded Health!

~Rose

Nov 022015
 

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 262015
 

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published! This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.