Apr 052016
 

Readers,

Open Minded Health is temporarily going to a biweekly post schedule. That is, posts will go from once a week to once every two weeks.

This is for a few reasons. My second year of medical school is coming to an end. I begin prepping for the first, and biggest, of the board exams next week. And I’ll be going into my clinical years in June. The clinical year is one of the busiest years in medical education, only surpassed by residency (the “internship” of medicine).

Going to a biweekly update schedule means updates can still come at regular intervals. I will do my best to make the posts more in depth so the wait is worth it.

I’m also working on a full update to Trans 101. I’ll let you all know when that’s done.

Thank you for continuing to read Open Minded Health!

~Rose

Nov 022015
 

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 262015
 

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published! This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

Oct 122015
 
Human Papilloma Virus

Human Papilloma Virus

Little is known about reproductive cancer risks among cisgender lesbian and bisexual women. Cancer registries generally don’t ask about sexual orientation. Studies suggest so far that lesbian and bisexual women are less likely to get a pelvic exam and pap smear when it’s recommended. Pap smears help to detect cancer in its earlier, most easily treated and cured stages. Logically, lesbian and bisexual women may be at risk for having more developed (and potentially incurable) cancers. The data confirming that aren’t in yet, but it seems likely.

And now we have HPV vaccines. The human papilloma virus is a major cause of cervical cancer, along with anal cancer, penile cancer, and mouth/throat cancers. Human papilloma virus spreads by skin-to-skin sexual contact regardless of biological sex or gender. Along with pap smears, the HPV vaccine has been a great tool for preventing advanced cervical cancers.

This week I looked at a study of survey data from 15-25 year old women from the National Survey of Family Growth, from 2006-2010. They asked the questions: “Have you heard of the HPV vaccine?” and “Have you received the HPV vaccine?”

The results were rather spectacular. Lesbian, bisexual, and straight women had heard of the HPV vaccine. There was no difference there. However, 28% of straight women, 33% of bisexual women and 8.5% of lesbian women received the HPV vaccine.

That’s 8.5% of lesbians vs 28-33% of non-lesbian women.

Why?? Lesbians are at risk for HPV infection too!

Before looking at what the authors thought, I have some thoughts of my own.

2006, the earliest year this study had data on, isn’t too far off from when I graduated high school. I remember the sex ed class we had. We were lucky to have sex ed at all. It was a one-day class focused on the effectiveness of birth control options, how to put a condom on a banana (or maybe it was a cucumber?), and sexually transmitted diseases that can be passed between men and women in penis-in-vagina sex. There was no discussion of sexually transmitted diseases that are passed between men who have sex with men or women who have sex with women. I remember walking out of the class feeling confused and alone — what STDs were passable between women, and how can women protect themselves and their partners? Were there diseases that women could spread? Was protection warranted? I had no idea.

The study authors discuss similar problems and attributed the difference between lesbian HPV vaccine and bisexual/heterosexual HPV vaccine to misinformation. The idea that lesbian women who have never had sexual contact with men don’t need pap smears or HPV vaccines is old and incorrect, but still persists. I remember when pap smears were recommended starting at first sexual contact with men — if a woman never had sexual contact with a man then she didn’t ever need a pap, right? Wrong!

But it takes time to correct misinformation. As the authors correctly point out, important changes have happened since 2010. HPV vaccine is now recommended for all young people regardless of sex, sexual activity, sexual orientation, or gender identity. It’s not just a vaccine for a sexually transmitted disease — it’s a vaccine against some forms of cancer. Pap smears are now recommended for everyone with a cervix every 3-5 years or so.

So can you be part of the change? Help spread the word about HPV vaccine for *all* people, and pap smears for people cervixes!

The study was published in the Annals of Internal Medicine. The abstract is publicly available.