Mar 282016
 

In the United States, spironolactone is the oral anti-androgen of choice for trans women. It’s the cheapest and is well tolerated by most people. Outside of the United States cyproterone acetate, also known as Androcur, is the preferred drug. This week I take a look at this drug, how it works, and why it hasn’t been approved for use in the United States.

The chemical structure of cyproterone

The chemical structure of cyproterone

Cyproterone is an anti-androgen. It blocks androgen receptors, preventing testosterone and other androgens from having their effects. By blocking those receptors, it reduces the amount of testosterone in the body through a mechanism called negative feedback. Cyproterone is chemically similar to progesterone and has some progesterone-like effects as well. Outside of transgender care it’s also used for prostate cancer, as combination antiandrogen and hormonal birth control for cis women (e.g., Dianette), and for chemical castration of sex offenders.

It’s available both as a pill and intramuscular injection. The pill form should be taken every day at the same time after a meal. The dose often used for transition in the literature is 100mg/day. Anecdotally I’ve been told that lower doses, such as 25-50mg/day, have been used. The injection is given once every 1-2 weeks.

Cyproterone acetate is not risk-free and is definitely not for everyone. Most seriously, cyproterone is associated with liver damage. That damage can be severe. It can lead to liver failure even after the drug is stopped. Damage has been reported with doses over 100mg/day. Because of this, people on cyproterone should have their livers regularly monitored with blood tests. The drug should not be combined with other drugs that can cause liver damage. That includes alcohol and many prescription drugs. Individuals with known liver damage/disease should not take cyproterone.

There is also some question of whether the drug is associated with some cancers. In particular, liver cancer and some brain cancers. Specifically, hepatocellular carcinoma and meningioma are the cancers of concern. Researchers are still exploring this connection. Other negative side effects of cyproterone include allergic reactions and worsening of depression.

Many trans women are concerned about fertility. The effects of cyproterone alone, without estrogen, on fertility are somewhat known. Sperm count goes down with oral doses as low as 50mg. Infertility can happen in as little as 2 months. The infertility is reversible once cyproterone is stopped. Fertility returns anywhere from 3-20 months. But remember — no anti-androgen is a birth control method. Please use birth control if you or your partner are at risk of pregnancy.

In the literature, 100mg/day is the dose that seems to be preferred for transition. No cases of liver cancer in trans women have been reported. However some women do have higher levels of liver enzymes. That’s a sign that the drug is causing some damage to liver cells. Transdermal, instead of oral, estrogen is recommended to reduce potential liver damage and blood clots.

Cyproterone is a potential alternative for trans women. So why hasn’t the FDA approved it? That’s a little murky. I wasn’t able to find public document describing the reasoning. But the biggest reason cited by other sources is the concern of liver damage. The FDA is likely trying to do its job and protect the population from drugs that cause more harm than good. In its efforts it may well overstretch. Cyproterone only rarely causes liver problems, and those problems can be screened for with regular blood tests. However it’s important to remember that there are safer alternatives still available. Spironolactone and the GnRH agonists (puberty blockers) are generally safer and mostly well tolerated. Other androgen receptor blockers (e.g., bicalutamide), while not in common use for trans care, are also available and have lower rates of liver damage. So there’s little pressure on the FDA to approve a riskier drug.

So in summary — cyproterone is an androgen receptor blocker in use outside the United States for trans care, prostate cancer, and birth control. It’s biggest side effect is potential liver damage. It’s not FDA-approved for use in the US probably because of that liver damage. People currently using the drug should be under a physician’s supervision.

Want to learn more? The wikipedia article on this drug is super excellent!

Note on references — I pulled most of my information from LexiComp, which I have access to through my university and can’t easily reference. However, prescribing information is publicly available and has much of the same information.

Nov 022015
 

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 262015
 

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published! This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

Jan 092015
 

This is the start of a new series of posts here on Open Minded Health: Quickies! I often run into items in the medical literature that are too short to do a fully post on, but for whatever reason I think it’s worth covering it anyway.

~~

This week’s quickie is a case report, which was presented as a poster at a medical conference.

7170317810_f25026d624_mA trans woman in her thirties showed up at the emergency room with gastrointestinal problems. She had nausea, pain, and bleeding. No significant medical history was noted in the report, and she was on a normal dose of hormone therapy.

When they took her blood to run some lab tests, the sample appeared “as white and turbid as milk.”

Her lab work revealed a triglyceride level of 30,000 mg/dl. For reference, a normal triglyceride level is less than 150. Above 500 is considered “very high.”

She was immediately transferred to the intensive care unit for treatment. Triglycerides that high can cause inflammation of the pancreas. Thankfully all her pancreatic lab values were normal. After a week of treatment, which managed to get her triglycerides down to 3,000, she was sent home. She was instructed to stop estrogen treatment, take new prescribed triglyceride-lowering medications, and to follow up with her physician.

Why did the hospital physicians recommend that this patient stop her estrogen? Because estrogen treatment is known to increase triglyceride levels. Triglyceride levels that high are extremely rare. A much more mild version can, however, happen to anyone who has high estrogen levels. It can happen to cis women in pregnancy or receiving hormone replacement therapy for menopause. It can also happen to trans women on estrogen treatment.

High triglyceride levels are usually “silent” — there are no symptoms. That’s part of the reason it’s important to see a physician regularly for screening, especially if you’re at higher risk. High triglyceride levels are more likely if you…

  • are overweight
  • don’t exercise
  • eat a high-carbohydrate, high-fat diet
  • have other cardiovascular issues
  • are on certain medications
  • or if it runs in your family

Mild elevations in triglyceride levels may be controllable with diet, exercise, and weight control. If those don’t help, your physician may prescribe medications to lower your triglycerides.

For more information on triglycerides, including what they are, normal levels, and how to control them…check out this article by WebMD or ask your primary care provider.

The case report inspiring this post was “Hypertriglyceridemia up to thirty thousand due to estrogen: Conservative Management” and was published in Critical Care Medicine.

Jan 042015
 

8787343055_a2a6eb06bf_mIt’s a new year here at Open Minded Health. I hope you all had a safe, fabulous, and fun new years celebration. Here at OMH it’s time for the yearly questions and answers post.

For the unfamiliar — once a year I take a deep look at all the search queries that bring people here. Often, they’re questions that I didn’t completely answer or that need answering. So in case anyone else has these questions — there are answers here now that Google can find. The questions are anonymous and I reword them to further anonymize them.

This year is all questions about transgender health issues. There’s been a lot published and a lot in the news about trans health issues lately. This next year I’ll try to find other articles to post about too, though. 🙂

Questions!

What are the healthier estrogens that a transgender woman can take?

In order from least risk to most risk: estrogen patch, estrogen injection sublingual/oral estradiol, oral ethinyl estradiol, oral premarin.

But note that that’s an incomplete picture. The estrogen patch isn’t the best for initial transition and is very expensive. Injectable estrogen means sticking yourself with a needle every 1-2 weeks and needing a special letter to fly with medications. By far the cheapest of these options is oral estradiol.

Ethinyl estradiol is the form of estrogen used in birth control. Premarin is conjugated equine estrogens, meaning they’re the estrogens from a pregnant horse. Neither should be the first choice for transition. They’re both higher risk than estradiol.

For transgender women, how long does it take to see the benefits of taking spironolactone?

The rule of thumb is 3 months before changes on hormone therapy.

Where is the incision placed in an orchiectomy for transgender women?

That depends on the surgeon. But I’m know you can find images and personal stories on /r/transhealth and transbucket.

Does a trans man have to stop taking hormones to give birth?

Yes. Trans men and others who can become pregnant who are taking testosterone must stop testosterone treatment before becoming pregnant. Testosterone can cross the placenta and cause serious problems for the fetus. Once the child is delivered and no longer breast feeding testosterone can be resumed.

Once you’re on female hormones, how long does it take to get hair down to your shoulders?

My understanding is that the speed that hair grows doesn’t change. It grows at roughly 1/2 an inch a month. Expect growing it out to shoulder length to take 2-3 years.

As a trans woman on estrogen, are there foods I should avoid?

If you’re on estrogen only, there are no foods you should avoid. Instead eat a healthy varied diet.

If you’re on spironolactone you may need to avoid foods that are high in potassium. Potato skins, sweet potatoes, bananas, and sports supplements are foods you may need to limit or avoid. Ask your physician if you need to avoid these foods.

Is there a special diet that can help me transition?

In general, no. Any effect that food may have is, in general, too subtle to make a difference. The possible exception is foods that are very high in phytoestrogens — like soy. Phytoestrogens are chemicals in plants that act a little like estrogen in the body. There are a few case reports in the medical literature of people developing breasts when they eat a lot (and I do mean a lot) of soy. But they’re unusual. Ask your physician before you make radical changes in your diet. In general — just eat a healthy, varied diet.

I’m a trans guy taking testosterone and having shortness of breath. Do I need to worry?

See a physician as soon as you can. Shortness of breath may be a sign of something serious. Taking testosterone raises your risk for polycythemia (too many red blood cells in the blood), which can manifest as shortness of breath.

How often do trans women get injections of estrogen?

Most women have their injection every week to two weeks.

Can I still masturbate while I’m on estrogen?

Yes. Many trans women have difficulty getting or maintaining an erection though.

Can I get a vaginoplasty before coming out as transgender or transitioning?

Generally speaking, no. Surgeons follow the WPATH standards of care which require hormone therapy and letters of recommendation from physicians and therapists before vaginoplasty.

Are there risks to having deep penetrative sex if you’re a trans woman?

I’m assuming you’re referring to vaginal sex post-vaginoplasty. The vagina after a vaginoplasty is not as stretchy or as sturdy as most cis vaginas. It’s possible to cause some tearing if the sex is vigorous or if there are sharp edges (e.g., a piercing or rough fingernails).

Things you can do that might help prevent injury: Make sure you’re well healed after surgery. Dilate regularly as recommended by your surgeon. Use lots of lubrication, and try to go gently at first. Topical estrogen creams may also be helpful for lubrication and flexibility.

Is it safe to be on trans hormone therapy if you have a high red blood count?

Depends. If you’re a trans man looking for testosterone, you may need treatment first to control the high red blood cell count. Testosterone encourages the body to make more red blood cells, which would make the problem worse.

What kinds of injection-free hormone therapy are available to trans men?

Topical testosterone is available for trans men. It’s a slower transition and it’s expensive, but it exists and it works. Oral testosterone should never be used because of the risk of liver damage.

What can cause cloudy vision in trans women on hormone therapy?

Seek medical care. It could be unrelated, but changes to vision are not a good sign.

~~

And that’s it for this year! Next week we’ll be back to normal posts. 🙂