Jun 122017
 

There are a lot of unknowns when it comes to hormone therapy for trans people. Which androgen is best for trans men? Are there long-term risks if they don’t have their ovaries or testes removed? And can we develop a way to give trans men testosterone that doesn’t involve needles or creams? This week’s paper tried to answer one question: What happens to trans men’s uteruses with all that testosterone?

Loverro et al recruited 12 trans men in Italy to participate. After examinations making sure they didn’t have any lurking cancers that might flourish with extra testosterone, they received intramuscular testosterone therapy. On average they were on testosterone for 32 months (roughly 2.5 years) before going on to have hysterectomy/oophorectomy. The uterus and ovaries wer then examined under the microscope. Estrogen and testosterone levels were also tracked throughout the study and up to one year after surgery.

What did they find?

First — a caveat. I’m not going to present all the nitty gritty details of the results. I don’t think the percent of Ki-67 receptors found in each tissue type is useful for most people. Nor do I think the details of exactly what their hormone levels were was useful. (They were in the therapeutic ranges). So I’m keeping my analysis here at the ten thousand foot view.

Loverro et al found that the uteruses did not atrophy with testosterone. The uteruses continued to be in an active state. Several trans men had a secretory uterus. That means their uteruses were building up the lining. In cis women that’s during the phase just before ovulation (when the egg is released). In trans men who don’t menstruate it’s harder to tell what’s going on. They also found that the muscular layer in the uterus was bigger, just like all muscles get bigger with testosterone.

When they examined the ovaries, they found that most of them were large with multiple follicles. The larger size was mostly from more connective tissue (collagen). That means more stuff in between the hormone producing cells, not more hormone producing cells. Multiple follicles were also found, just like in polycystic ovarian syndrome. That is a known effect of testosterone. And just like in PCOS, the larger follicles probably caused fewer menses. All of these ovarian changes were likely an effect of the testosterone.

That’s nice and all. But what does it mean?

It’s important to know that the uterus does not atrophy. That means trans men are still at risk for endometrial and uterine cancers. We don’t have any long term information on whether trans men are at high, low, or average risk for those cancers. However trans men should definitely seek medical advice if they experience spotting, cramping, or unexplained weight loss. As always, they should follow up with a primary care provider, like a family medicine, internal medicine, or ob/gyn doctor.

Want to read the study for yourself? The abstract is publicly available.

Aug 012016
 

Welcome back to Open Minded Health Promotion! This week we’re looking at health promotion for transgender men and individuals assigned female at birth. Depending on your history some of these tips will apply more or less to you.

TransgenderPlease remember that these are specific aspects of health in addition to the standard recommendations for everyone (e.g., colonoscopy at age 50). Based on your health and your history, your doctor may have different recommendations for you. Listen to them.

All transgender men should consider…
  • Talk with their doctor about their physical and mental health
  • Practice safer sex where possible. Sexually transmitted infections can be prevented with condoms, dental dams, and other barriers. If you share sexual toys consider using condoms/barriers or cleaning them between uses.
  • Consider using birth control methods if applicable. Testosterone is not an effective method of birth control. In fact, testosterone is bad for fetuses and masculinizes them too. Non-hormonal options for birth control include condoms, copper IUDs, diaphragms and spermicidal jellies.
  • If you’re under the age of 26, get the HPV vaccine. This will reduce the chance for cervical, vaginal, anal, and oral cancers.
  • Avoid tobacco, limit alcohol, and limit/avoid other drugs. If you choose to use substances and are unwilling to stop, consider strategies to limit your risk. For example, consider participating in a clean needle program. Vaporize instead of smoke. And use as little of the drug as you can.
  • Maintain a healthy weight. While being heavy sometimes helps to hide unwanted curves, it’s also associated with heart disease and a lower quality of life.
  • Exercise regularly. Anything that gets your heart rate up and gets you moving is good for your body and mind! Weight bearing exercise, like walking and running, is best for bone health.
  • Be careful when weight lifting if you’re newly taking testosterone. Muscles grow faster than tendon, thus tendons are at risk for damage when you’re lifting until they catch up.
  • Consider storing eggs before starting testosterone if you want genetic children. Testosterone may affect your fertility. Consult a fertility expert if you need advising.
  • Seek help if you’re struggling with self injury, anorexia, or bulimia. Trans men are at higher risk than cis men for these aspects of mental health.
  • If you have unexplained vaginal bleeding, are on testosterone, and have not had a hysterectomy notify your doctor immediately. Some “breakthrough” bleeding is expected in the first few months of testosterone treatment. Once your dose is stable and your body has adapted to the testosterone you should not be bleeding. Bleeding may be benign but it may also be a sign that something more serious is going on. Contact your doctor.
  • In addition, talk with your doctor if you have pain in the pelvic area that doesn’t go away. This may also need some investigation. And s/he may be able to help relieve the pain.
  • Be as gentle as you can with binding. Make sure you allow your chest to air out because the binding may weaken that skin and put you at risk for infection. Be especially careful if you have a history of lung disease or asthma because tight binding can make it harder to breathe. You may need your inhaler more frequently if you have asthma and you’re binding. If this is the case, talk with your doctor.
  • If you’ve had genital surgery and you’re all healed from surgery: there are no specific published recommendations for caring for yourself at this point. So keep in touch with your doctor as you need to. Call your surgeon if something specific to the surgery is concerning. Continue to practice safe sex. And enjoy!
Your doctor may wish to do other tests, including…
  • Cervical cancer screening (if you have a cervix). The recommendation is every 3-5 years minimum, starting at age 21. Even with testosterone, this exam should not be painful. Talk with your doctor about your needs and concerns. Your doctor may offer a self-administered test as an alternative. Not every doctor offers a self-administered test.
  • Mammography even if you’ve had chest reconstruction. We simply don’t know what the risk of breast cancer is after top surgery because breast tissue does remain after top surgery. Once you turn 50, consider talking with your doctor about the need for mammography. In addition, if you’re feeling dysphoric discussing breast cancer then it may be helpful to remember that cis men get breast cancer too.
  • If you have not had any bottom surgery you may be asked to take a pregnancy test. This may not be intended as a transphobic question. Some medications are extremely harmful to fetuses. Hence doctors often check whether someone who can become pregnant is pregnant before prescribing. Cisgender lesbians get this question too, even if they’ve never had contact with cisgender men.

And most importantly: Take care of your mental health. We lose far too many people every year to suicide. Perhaps worse, far more struggle with depression and anxiety. Do what you need to do to take care of you. If your normal strategies aren’t working then reach out. There is help.

Want more information? You can read more from UCSF’s Primary Care Protocols and the Gay and Lesbian Medical Association.

Jan 112016
 

Happy new year! I hope everyone had a safe and relaxing holiday season. And welcome back! Thanks, as always, for sticking around while I took care of other business. Let’s get started.

~~

Vocal cords -- the source of our voice and pitch

Vocal cords — the source of our voice and pitch

This week’s article comes out of Sweden, and asks the question “When we measure voices in the lab, how quickly and how well does testosterone change the voice of trans men?” Testosterone’s effects on voice have been the subject of blessings and curses (by trans men and trans women, respectively) but have received little attention by researchers.

This study was relatively simple — invite 50 trans men to participate, ask them to read into a machine every 3 months as they start testosterone, survey them, and look at their testosterone blood levels.

The men in this study varied in age, from 18 year old men just swapping from puberty blockers to testosterone to 64 year old men. All had never taken testosterone before. Testosterone forms included both intramuscular injection and transdermal (patches/gels/creams). By 3 months into treatment all the men had male testosterone levels in their blood.

So now that we know a bit about who participated…what happened in this study?

Every three months the men came into the lab and were recorded reading. The pitch and force of their voice was analyzed. Most of the study’s details of how they analyzed it is beyond me (I don’t have a foundation in voice analysis), but the results are clear. By 12 months on testosterone their voices had stopped changing. The most change happened in the first 6 months. On average their voices went from a fundamental frequency of 192 Hertz (Hz) at the beginning to 155 Hz after 3 months and finally ended up at 125 Hz. If you want to hear what those sound like, plug those numbers into this website. There was a lot of variation where their voices started out at, and a lot of variation what their voices changed to. Six of the men stayed around 143-170 Hz. Ten men started out lower than 175 Hz.

Fundamental frequency is a fancy term for pitch. On average cis men range from 85 to 155 Hz, and cis women range from 165 to 255 Hz, for reference. The type of testosterone didn’t seem to have a big effect on when voices changed or what they changed to.

What about how the men felt about their voices and whether or not the change was heard by others? The lower the pitch, the more satisfied the men felt about their voice and the more likely they were to report that they were correctly gendered on the phone. By the end of 12 months satisfaction with their voice was higher, with the most change happening between 3 and 6 months.

But it wasn’t all positive for every participant. Twelve men of the 50 also sought voice therapy. Reasons varied from vocal fatigue to the voice not being low enough to instability, strain, or hoarseness. They attended an average of 3 vocal therapy sessions. How well those sessions helped wasn’t measured.

So what’s the important stuff to take away from this study?

  • After 12 months most trans men’s voices have dropped into the male range, but individual results vary.
  • The most significant change in voice happens in the first 6 months of testosterone treatment, but changes continue to 12 months.
  • Some trans men may desire voice therapy during that first year

It’s also worth noting that this was the first published longitudinal study of trans male voices and how they change on testosterone.

What do you think? Do the study results reflect your own experiences or the experiences of your friends and loved ones? Did the researchers miss anything big? Let me know in the comments!

Want to read the study for yourself? The abstract is publicly available.

Nov 022015
 

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Jun 152015
 

Mortier_PillonTestosterone replacement therapy has become nearly common place recently. Marketing of testosterone creams is everywhere. In addition to the big pharmaceutical companies, compounding pharmacies are now making and selling testosterone creams too. Compounding pharmacies are typically small local pharmacies where the medications are made and mixed on site. A compounded medication can be helpful to someone who, for example, is allergic to a filler used in a commercial product. Compounded products are often cheaper than commercial non-generic products. Compounded products are supposed to be standardized just like commercial products are. But are they?

The Federal Food and Drug Administration (United States) produced a report back in 2006 that showed that somewhere around 33% of compounding pharmacies were not making or selling standardized products.

Now a Canadian study confirms that compounding pharmacies may not be well standardized either. The researches took samples at two different times from ten randomly selected compounding pharmacies in Toronto. The samples were then analyzed and compared to two different commercial forms.

The commercial forms were consistently within 20% of the prescribed dose. Only 50% of the compounded forms in the first batch were within those limits. Worse, only 30%  of the second compounded batch were within that limit. Yikes! One pharmacy even had no testosterone in its product at all. The consistency within a pharmacy’s products also varied wildly. One pharmacy had 91% of the of the testosterone it was supposed to have in one sample, and only 8% in another sample.

The compounded testosterone was generally cheaper than the commercial testosterone. Compounded testosterone ranged from $57-161 for a 30-day supply, averaging around $105. The commercial stuff was $140-150 for 30-days.

This has very serious concerns for patients. Wild swings in testosterone level are not safe. For their safety and health, a patient should receive the dose that was prescribed. Not “half the dose one month” and “double the dose the next”. The lower price of the compounded products could easily lure a lower income patient into purchasing the compound instead of the commercial.

What can you do as a patient? Make sure that you get your prescriptions from a non-compounding pharmacy. If cost is an issue, talk with your pharmacist about using a generic. Generics are held to the same standards are brand-name drugs and are often made by the same company. Alternatively, consider discussing medication options with your physician and/or pharmacist.

Want to read the study for yourself? The abstract is publicly available!