Nov 022015

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 262015

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published! This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

Oct 122015
Human Papilloma Virus

Human Papilloma Virus

Little is known about reproductive cancer risks among cisgender lesbian and bisexual women. Cancer registries generally don’t ask about sexual orientation. Studies suggest so far that lesbian and bisexual women are less likely to get a pelvic exam and pap smear when it’s recommended. Pap smears help to detect cancer in its earlier, most easily treated and cured stages. Logically, lesbian and bisexual women may be at risk for having more developed (and potentially incurable) cancers. The data confirming that aren’t in yet, but it seems likely.

And now we have HPV vaccines. The human papilloma virus is a major cause of cervical cancer, along with anal cancer, penile cancer, and mouth/throat cancers. Human papilloma virus spreads by skin-to-skin sexual contact regardless of biological sex or gender. Along with pap smears, the HPV vaccine has been a great tool for preventing advanced cervical cancers.

This week I looked at a study of survey data from 15-25 year old women from the National Survey of Family Growth, from 2006-2010. They asked the questions: “Have you heard of the HPV vaccine?” and “Have you received the HPV vaccine?”

The results were rather spectacular. Lesbian, bisexual, and straight women had heard of the HPV vaccine. There was no difference there. However, 28% of straight women, 33% of bisexual women and 8.5% of lesbian women received the HPV vaccine.

That’s 8.5% of lesbians vs 28-33% of non-lesbian women.

Why?? Lesbians are at risk for HPV infection too!

Before looking at what the authors thought, I have some thoughts of my own.

2006, the earliest year this study had data on, isn’t too far off from when I graduated high school. I remember the sex ed class we had. We were lucky to have sex ed at all. It was a one-day class focused on the effectiveness of birth control options, how to put a condom on a banana (or maybe it was a cucumber?), and sexually transmitted diseases that can be passed between men and women in penis-in-vagina sex. There was no discussion of sexually transmitted diseases that are passed between men who have sex with men or women who have sex with women. I remember walking out of the class feeling confused and alone — what STDs were passable between women, and how can women protect themselves and their partners? Were there diseases that women could spread? Was protection warranted? I had no idea.

The study authors discuss similar problems and attributed the difference between lesbian HPV vaccine and bisexual/heterosexual HPV vaccine to misinformation. The idea that lesbian women who have never had sexual contact with men don’t need pap smears or HPV vaccines is old and incorrect, but still persists. I remember when pap smears were recommended starting at first sexual contact with men — if a woman never had sexual contact with a man then she didn’t ever need a pap, right? Wrong!

But it takes time to correct misinformation. As the authors correctly point out, important changes have happened since 2010. HPV vaccine is now recommended for all young people regardless of sex, sexual activity, sexual orientation, or gender identity. It’s not just a vaccine for a sexually transmitted disease — it’s a vaccine against some forms of cancer. Pap smears are now recommended for everyone with a cervix every 3-5 years or so.

So can you be part of the change? Help spread the word about HPV vaccine for *all* people, and pap smears for people cervixes!

The study was published in the Annals of Internal Medicine. The abstract is publicly available.

Oct 052015

480px-RGB_LED_Rainbow_from_7th_symmetry_cylindrical_gratingI’ve been saying for years now that the phrase “LGBT community” is insufficient when it comes to health. It’s not one community — it is multiple communities. The social issues and health issues that a gay transgender man faces every day are different from the issues a bisexual cisgender woman faces every day. There are some similarities and grouping the communities together has been politically useful. But it should never be forgotten that L, G, B, and T all face different types of health concerns and have different civil rights battles to face.

A study came out in August that has to be one of my favorites this year. Researchers in Georgia surveyed over three thousand lesbian, gay, bisexual, pansexual, transgender, gender non-conforming, and queer people. They asked about health behaviors of all kinds. And then they did statistical analysis, comparing the various genders (cis male, cis female, trans male, trans female, genderqueer) and sexual orientations (lesbian, gay, bisexual, pansexual, queer, straight). Let’s look at what they found!

  • Diet and exercise: The researchers asked about fatty foods, eating while not hungry, quantity of vegetables and fruits eaten, and about hours and types of exercise. Transgender women had the least healthy diet of all genders. As a group, they were less likely to eat many fruits and vegetables, and more likely to drink sugared drinks and eat when they weren’t hungry. Both cisgender and transgender men were also less likely to eat many vegetables compared with other groups. Genderqueer people and gay cisgender men were most likely to exercise.
  • Substance use: The researchers asked about smoking tobacco and alcohol consumption. Cisgender men were the most likely to drink alcohol, binge drink, and to drink even when they didn’t want to. Participants who identified as queer were also more likely to drink. When it came to tobacco, transgender men and straight participants were the most likely to smoke.
  • Motor vehicle risk: The researchers asked about seatbelt use, speeding, and texting while driving. No clear differences for speeding were noted. Transgender men and straight participants were most likely to drive without a seatbelt. Texting while driving varied considerably; gay and lesbian drivers were most likely to text while driving.
  • Sexual behaviors: The researchers asked about frequency of unprotected sex and sex while intoxicated. Gay men were least likely to have unprotected sex while lesbian women were most likely to have unprotected sex. When it came to sex while intoxicated, only the bisexual participants stood out as being most likely among the groups to have sex while intoxicated.
  • Violence: The researchers asked about self harm and expressing anger at others. Overall rates of interpersonal anger were very low. Transgender men and pansexual people were most likely to self harm.
  • Medical risk taking: The researchers asked about delaying medical care and not following physician advice. Transgender women were least likely to seek care; 1/3 reported that they regularly delayed seeking medical care. Both transgender women and transgender men were more likely to not follow medical advice when it was given. Bisexual people were also more likely to delay seeking medical care compared to lesbian and gay participants.

That’s a mouthful, right? There are a lot of details I left out of this summary and it still threatens to be overwhelming with detail. So how we can break this down even more simply? By talking about the conclusions.

The researchers go into some possible causes for all these different results. Maybe gay men are safer about sex because of HIV risk. Maybe transgender men eat few vegetables because of cultural expectations that “men eat lots of meat and not many vegetables.” Maybe gay and lesbian people text more while driving because of the lack of community-specific messages.

Maybe. And they’re all good thoughts.

I tend to look forward more to what we can do with these data. I’m pretty happy with this study — it’s one of the broadest I’ve seen for inclusion. Few health-oriented pieces of research include pansexual and genderqueer individuals.

It’s important to remember that these results are at the group level. Any individual person who is a gender/sexual minority will have their own health behaviors and risks. They should be evaluated and treated as individuals. From a public health perspective though, this research brings valuable data. Only by knowing what each group faces can prevention, screening, and treatment campaigns be created. Only by knowing, for example, that transgender and bisexual people avoid seeking medical care can we then examine “why?” and act to remove the barriers so that appropriate, respectful medical care is available.

So — can we change the conversation? Instead of talking about “the LGBT community”, let’s talk about “the LGBT communities”. Or, even better, “gender and sexual minority communities” — removing the alphabet soup and expanding the definitions at the same time. This research is only the tip of the iceberg. We have so much more to explore.

The paper is published online ahead of print. The abstract is publicly available.

Aug 312015

The Greek letter Psy is often used to symbolize psychology or the APA.

The American Psychological Association has released a 55-page document detailing guidelines for psychologists treating transgender and gender non-conforming individuals. To my knowledge, this is the first such document the APA has published. It’s a huge milestone in trans mental health care.

APA guidelines provide standards for both trainees and practicing psychologists on the expected conduct of psychologists. They’re used in both introductory and continuing education.

In this document, the APA lists out the following guidelines (note that TGNC stands for “transgender/gender non-conforming”):

  1. Psychologists understand that gender is a non‐binary construct that allows for a range of gender identities and that a person’s gender identity may not align with sex assigned at birth.
  2. Psychologists understand that gender identity and sexual orientation are distinct but interrelated constructs.
  3. Psychologists seek to understand how gender identity intersects with the other cultural identities of TGNC people.
  4. Psychologists are aware of how their attitudes about and knowledge of gender identity and gender expression may affect the quality of care they provide to TGNC people and their families.
  5. Psychologists recognize how stigma, prejudice, discrimination, and violence affect the health and well‐being of TGNC people.
  6. Psychologists strive to recognize the influence of institutional barriers on the lives of TGNC people and to assist in developing TGNC‐affirmative environments.
  7. Psychologists understand the need to promote social change that reduces the negative effects of stigma on the health and well‐being of TGNC people.
  8. Psychologists working with gender questioning and TGNC youth understand the different developmental needs of children and adolescents and that not all youth will persist in a TGNC identity into adulthood.
  9. Psychologists strive to understand both the particular challenges that TGNC elders experience and the resilience they can develop.
  10. Psychologists strive to understand how mental health concerns may or may not be related to a TGNC person’s gender identity and the psychological effects of minority stress.
  11. Psychologists recognize that TGNC people are more likely to experience positive life outcomes when they receive social support or trans‐affirmative care.
  12. Psychologists strive to understand the effects that changes in gender identity and gender expression have on the romantic and sexual relationships of TGNC people.
  13. Psychologists seek to understand how parenting and family formation among TGNC people take a variety of forms.
  14. Psychologists recognize the potential benefits of an interdisciplinary approach when providing care to TGNC people and strive to work collaboratively with other providers.
  15. Psychologists respect the welfare and rights of TGNC participants in research and strive to represent results accurately and avoid misuse or misrepresentation of findings.
  16. Psychologists seek to prepare trainees in psychology to work competently with TGNC people.
This is all excellent.
There is a history of psychologists attempting to change gender identity through conversion therapy or other coercive means. The APA’s statement, in effect, states very strongly that attempts to change gender identity should not be attempted. Instead, the APA is embracing the ethical treatment of transgender people and of affirming transgender and gender non-conforming people.
Do these guidelines mean anything for you if you’re receiving therapy? Possibly. Talk with your therapist, whether you’re trans or cis, to make sure they’ve seen the updated guidelines. If you’re receiving therapy that is not within these guidelines, consider talking with your therapist about these guidelines or seeking another therapist.
And spread the word! The document itself is publicly available as a PDF.