Jul 182016

Transgender youth are a special population. Because of the relative novelty of treatment at any age much less for youth, data are scarce. A recent review article examining the published data on transgender youth was published. Let’s take a look at what they found.

First, how about prevalence? How many youth self identify as transgender? There are very, very, few studies that get good numbers on this. One study in New Zealand found that 1.2% of secondary school children identified as transgender, and 2.5% weren’t sure about their gender.

As we well know, being a gender and sexual minority can often be associated with health disparities. And this review reports on that too. Identifying as transgender was associated with negative psychological health. Specifically, being bullied, having symptoms of depression, attempting self harm, and attempting suicide were all more common in transgender youth than in cisgender youth. How much of that was because of discrimination and how much was because of gender dysphoria was not explored.

Researchers have also found that being transgender and having autism appear to go together. No one is quite sure why yet. There’s still a lot of research to be done to figure that out.

One interesting difference in the literature stands out to me, though. It appears that transgender men are more likely to self harm and transgender women are more likely to be autistic. Among cisgender people, cis women are more likely to self harm and cis men are more likely to be autistic. There are theories for why that sex difference exists, but there’s little to no agreement. It could be related to social environments, hormones, the environment in the womb, or any number of other factors. But the observation that transgender men and women more resemble their sex than their gender for self harm and autism is worth investigating further.

What about the effects of hormone therapy for transgender youth? Especially puberty suppression, which is the unique factor for their treatment? As a reminder, the treatment of transgender youth is largely based on the Dutch model. At puberty, children go on puberty suppressing drugs. They then go on hormones (and thus begin puberty) at age 16 and are eligible for surgery at age 18. There are efforts to deliver cross-sex hormones earlier, but the Dutch model is the standard that most of the research is based on. A Dutch study found that the psychological health of transgender youth improved after surgery. Their psychological health even equalled that of their cisgender peers! The researchers also found that youth continued to struggle with body image throughout the time they were on puberty suppression only. But their self-image improved with hormone therapy and surgery. None of the children regretted transitioning. And they said that social transition was “easy”.

One challenge to that particular Dutch study is that the Dutch protocol excludes trans youth who have significant psychiatric issues. A young person with unmanaged schizophrenia, severe depression, or other similar issue wouldn’t be allowed to start hormones. So the research was only on relatively psychologically healthy youth to begin with. It’s difficult to say if that had an effect on the study’s results. It’s also difficult to say whether the psychological health of a trans youth is the cause or the result of their dysphoria. A trans youth with depression might well benefit from hormone therapy, after all.

There are multiple questions still unresolved when it comes to treating transgender children. Does puberty suppression have a long term effect on their bones? Are there long-term physical or psychological health effects of early transition? How should children with serious psychological conditions be treated (besides the obvious answer — with compassion)? And on, and on.

The medical and scientific communities are working on answering these questions. But it will take time. And in the mean time — physicians and families do they best they can with what information we have. If you have, or are, a transgender youth please consider participating in a study so we can do even better for children in the future.

Want to read the review for yourself? The abstract is publicly available.

Nov 022015

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 052015

480px-RGB_LED_Rainbow_from_7th_symmetry_cylindrical_gratingI’ve been saying for years now that the phrase “LGBT community” is insufficient when it comes to health. It’s not one community — it is multiple communities. The social issues and health issues that a gay transgender man faces every day are different from the issues a bisexual cisgender woman faces every day. There are some similarities and grouping the communities together has been politically useful. But it should never be forgotten that L, G, B, and T all face different types of health concerns and have different civil rights battles to face.

A study came out in August that has to be one of my favorites this year. Researchers in Georgia surveyed over three thousand lesbian, gay, bisexual, pansexual, transgender, gender non-conforming, and queer people. They asked about health behaviors of all kinds. And then they did statistical analysis, comparing the various genders (cis male, cis female, trans male, trans female, genderqueer) and sexual orientations (lesbian, gay, bisexual, pansexual, queer, straight). Let’s look at what they found!

  • Diet and exercise: The researchers asked about fatty foods, eating while not hungry, quantity of vegetables and fruits eaten, and about hours and types of exercise. Transgender women had the least healthy diet of all genders. As a group, they were less likely to eat many fruits and vegetables, and more likely to drink sugared drinks and eat when they weren’t hungry. Both cisgender and transgender men were also less likely to eat many vegetables compared with other groups. Genderqueer people and gay cisgender men were most likely to exercise.
  • Substance use: The researchers asked about smoking tobacco and alcohol consumption. Cisgender men were the most likely to drink alcohol, binge drink, and to drink even when they didn’t want to. Participants who identified as queer were also more likely to drink. When it came to tobacco, transgender men and straight participants were the most likely to smoke.
  • Motor vehicle risk: The researchers asked about seatbelt use, speeding, and texting while driving. No clear differences for speeding were noted. Transgender men and straight participants were most likely to drive without a seatbelt. Texting while driving varied considerably; gay and lesbian drivers were most likely to text while driving.
  • Sexual behaviors: The researchers asked about frequency of unprotected sex and sex while intoxicated. Gay men were least likely to have unprotected sex while lesbian women were most likely to have unprotected sex. When it came to sex while intoxicated, only the bisexual participants stood out as being most likely among the groups to have sex while intoxicated.
  • Violence: The researchers asked about self harm and expressing anger at others. Overall rates of interpersonal anger were very low. Transgender men and pansexual people were most likely to self harm.
  • Medical risk taking: The researchers asked about delaying medical care and not following physician advice. Transgender women were least likely to seek care; 1/3 reported that they regularly delayed seeking medical care. Both transgender women and transgender men were more likely to not follow medical advice when it was given. Bisexual people were also more likely to delay seeking medical care compared to lesbian and gay participants.

That’s a mouthful, right? There are a lot of details I left out of this summary and it still threatens to be overwhelming with detail. So how we can break this down even more simply? By talking about the conclusions.

The researchers go into some possible causes for all these different results. Maybe gay men are safer about sex because of HIV risk. Maybe transgender men eat few vegetables because of cultural expectations that “men eat lots of meat and not many vegetables.” Maybe gay and lesbian people text more while driving because of the lack of community-specific messages.

Maybe. And they’re all good thoughts.

I tend to look forward more to what we can do with these data. I’m pretty happy with this study — it’s one of the broadest I’ve seen for inclusion. Few health-oriented pieces of research include pansexual and genderqueer individuals.

It’s important to remember that these results are at the group level. Any individual person who is a gender/sexual minority will have their own health behaviors and risks. They should be evaluated and treated as individuals. From a public health perspective though, this research brings valuable data. Only by knowing what each group faces can prevention, screening, and treatment campaigns be created. Only by knowing, for example, that transgender and bisexual people avoid seeking medical care can we then examine “why?” and act to remove the barriers so that appropriate, respectful medical care is available.

So — can we change the conversation? Instead of talking about “the LGBT community”, let’s talk about “the LGBT communities”. Or, even better, “gender and sexual minority communities” — removing the alphabet soup and expanding the definitions at the same time. This research is only the tip of the iceberg. We have so much more to explore.

The paper is published online ahead of print. The abstract is publicly available.

Aug 312015

The Greek letter Psy is often used to symbolize psychology or the APA.

The American Psychological Association has released a 55-page document detailing guidelines for psychologists treating transgender and gender non-conforming individuals. To my knowledge, this is the first such document the APA has published. It’s a huge milestone in trans mental health care.

APA guidelines provide standards for both trainees and practicing psychologists on the expected conduct of psychologists. They’re used in both introductory and continuing education.

In this document, the APA lists out the following guidelines (note that TGNC stands for “transgender/gender non-conforming”):

  1. Psychologists understand that gender is a non‐binary construct that allows for a range of gender identities and that a person’s gender identity may not align with sex assigned at birth.
  2. Psychologists understand that gender identity and sexual orientation are distinct but interrelated constructs.
  3. Psychologists seek to understand how gender identity intersects with the other cultural identities of TGNC people.
  4. Psychologists are aware of how their attitudes about and knowledge of gender identity and gender expression may affect the quality of care they provide to TGNC people and their families.
  5. Psychologists recognize how stigma, prejudice, discrimination, and violence affect the health and well‐being of TGNC people.
  6. Psychologists strive to recognize the influence of institutional barriers on the lives of TGNC people and to assist in developing TGNC‐affirmative environments.
  7. Psychologists understand the need to promote social change that reduces the negative effects of stigma on the health and well‐being of TGNC people.
  8. Psychologists working with gender questioning and TGNC youth understand the different developmental needs of children and adolescents and that not all youth will persist in a TGNC identity into adulthood.
  9. Psychologists strive to understand both the particular challenges that TGNC elders experience and the resilience they can develop.
  10. Psychologists strive to understand how mental health concerns may or may not be related to a TGNC person’s gender identity and the psychological effects of minority stress.
  11. Psychologists recognize that TGNC people are more likely to experience positive life outcomes when they receive social support or trans‐affirmative care.
  12. Psychologists strive to understand the effects that changes in gender identity and gender expression have on the romantic and sexual relationships of TGNC people.
  13. Psychologists seek to understand how parenting and family formation among TGNC people take a variety of forms.
  14. Psychologists recognize the potential benefits of an interdisciplinary approach when providing care to TGNC people and strive to work collaboratively with other providers.
  15. Psychologists respect the welfare and rights of TGNC participants in research and strive to represent results accurately and avoid misuse or misrepresentation of findings.
  16. Psychologists seek to prepare trainees in psychology to work competently with TGNC people.
This is all excellent.
There is a history of psychologists attempting to change gender identity through conversion therapy or other coercive means. The APA’s statement, in effect, states very strongly that attempts to change gender identity should not be attempted. Instead, the APA is embracing the ethical treatment of transgender people and of affirming transgender and gender non-conforming people.
Do these guidelines mean anything for you if you’re receiving therapy? Possibly. Talk with your therapist, whether you’re trans or cis, to make sure they’ve seen the updated guidelines. If you’re receiving therapy that is not within these guidelines, consider talking with your therapist about these guidelines or seeking another therapist.
And spread the word! The document itself is publicly available as a PDF.
Mar 162015

170px-Rod_of_Asclepius2.svgBeing a gender or sexual minority (GSM) is not only difficulty and tricky for patients — it can also be a challenge for medical providers. Medicine can be a particularly conservative field, depending on location and specialty. Lives are, after all, often at stake.

Despite recent advances it appears that some 40% of lesbian, gay and bisexual medical students are hiding their sexual minority status in medical school. Among transgender medical students, 70% were hiding their identity. All because of fear of discrimination.

That fear has been, and still is, warranted. From medical providers transitioning and losing their practices, to medical students losing their residency slots, to LGBT health student organizations fighting to exist, LGBT providers face similar discrimination as our patients.  Similar happens for other gender and sexual minority health care providers, though we lack statistics. At a meeting of kink-identified mental health care providers, one attendee noted a high level of vulnerability for the clinicians. Being “outed” could lose them their jobs or even trigger legal action.

To some extent, discretion among health care providers is warranted. Most people don’t want to know about their clinician’s (or coworker’s) personal lives. And most GSM providers don’t actually want to share those most intimate details. It’s where the line is that can be distressing — how much information is too much? Can I discuss my wife when other women clinicians are discussing their husbands? How exactly do you notify your fellow clinicians or patients about a change in gender pronouns or name? How can a clinician use information gained from intimate encounters to help patients, without revealing too much? It’s a balance we constantly seek. Sometimes mentors are there and can help. Other times we figure it out as we go along.

Yet we bring a lot to the table, as minorities. Like many racial and ethnic minorities, there are pressures and issues that affect GSM people more than the majorities. We bring that knowledge with us to the research we choose to perform, the communities we participate in, and each and every patient encounter.

We as clinicians and future clinicians need to have the support in order to be appropriately open about our gender and sexual minority status. Our patients and clients must know they can be safe and honest with us so they can receive the most complete and respectful care possible.

Some progress has been made already. There’s an association for LGBT medical professionals. There’s an association for kink psychological research. There’s an association for transgender health. All of which allow student members and provide mentoring. Many other organizations exist too. Some US medical schools are working with their students to provide a safe and welcoming environment where these issues can be explored. The American Association of Medical Colleges recently launched a program to enhance education surrounding LGBT and intersex health care. The American Medical Association also has an LGBT Advisory committee.

I’m proud to say that my medical school has been accepting and supportive of its gender and sexual minority patients, and that clinics in the area of my medical school are seeking to expand their care to be more inclusive of LGBT patients. Support exists for both those seeking medical care, and those seeking to provide that care. It’s only the beginning.