Jul 182016
 

Transgender youth are a special population. Because of the relative novelty of treatment at any age much less for youth, data are scarce. A recent review article examining the published data on transgender youth was published. Let’s take a look at what they found.

First, how about prevalence? How many youth self identify as transgender? There are very, very, few studies that get good numbers on this. One study in New Zealand found that 1.2% of secondary school children identified as transgender, and 2.5% weren’t sure about their gender.

As we well know, being a gender and sexual minority can often be associated with health disparities. And this review reports on that too. Identifying as transgender was associated with negative psychological health. Specifically, being bullied, having symptoms of depression, attempting self harm, and attempting suicide were all more common in transgender youth than in cisgender youth. How much of that was because of discrimination and how much was because of gender dysphoria was not explored.

Researchers have also found that being transgender and having autism appear to go together. No one is quite sure why yet. There’s still a lot of research to be done to figure that out.

One interesting difference in the literature stands out to me, though. It appears that transgender men are more likely to self harm and transgender women are more likely to be autistic. Among cisgender people, cis women are more likely to self harm and cis men are more likely to be autistic. There are theories for why that sex difference exists, but there’s little to no agreement. It could be related to social environments, hormones, the environment in the womb, or any number of other factors. But the observation that transgender men and women more resemble their sex than their gender for self harm and autism is worth investigating further.

What about the effects of hormone therapy for transgender youth? Especially puberty suppression, which is the unique factor for their treatment? As a reminder, the treatment of transgender youth is largely based on the Dutch model. At puberty, children go on puberty suppressing drugs. They then go on hormones (and thus begin puberty) at age 16 and are eligible for surgery at age 18. There are efforts to deliver cross-sex hormones earlier, but the Dutch model is the standard that most of the research is based on. A Dutch study found that the psychological health of transgender youth improved after surgery. Their psychological health even equalled that of their cisgender peers! The researchers also found that youth continued to struggle with body image throughout the time they were on puberty suppression only. But their self-image improved with hormone therapy and surgery. None of the children regretted transitioning. And they said that social transition was “easy”.

One challenge to that particular Dutch study is that the Dutch protocol excludes trans youth who have significant psychiatric issues. A young person with unmanaged schizophrenia, severe depression, or other similar issue wouldn’t be allowed to start hormones. So the research was only on relatively psychologically healthy youth to begin with. It’s difficult to say if that had an effect on the study’s results. It’s also difficult to say whether the psychological health of a trans youth is the cause or the result of their dysphoria. A trans youth with depression might well benefit from hormone therapy, after all.

There are multiple questions still unresolved when it comes to treating transgender children. Does puberty suppression have a long term effect on their bones? Are there long-term physical or psychological health effects of early transition? How should children with serious psychological conditions be treated (besides the obvious answer — with compassion)? And on, and on.

The medical and scientific communities are working on answering these questions. But it will take time. And in the mean time — physicians and families do they best they can with what information we have. If you have, or are, a transgender youth please consider participating in a study so we can do even better for children in the future.

Want to read the review for yourself? The abstract is publicly available.

Nov 022015
 

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 262015
 

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published! This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

Jul 132015
 
CDC_edamame

Soybeans, a common source of phytoestrogens

Have you heard that some herbs and foods contain chemicals called “phytoestrogens” that work like estrogen in the body? Ever seen products being sold over the counter advertised to “feminize naturally” or “prevent hot flashes during menopause”? Or read conversations online about using over the counter products to feminize instead of prescribed hormones? Did you stop and wonder if there was truth to the claims? Let’s do a quick overview and do some debunking!

What are phytoestrogens?

Phytoestrogens are estrogen-like chemicals made by plants. Just like how the tobacco plant makes nicotine to defend itself against insects, phytoestrogens are thought to have a protective effect for the plant. One of the most commonly known phytoestrogen is soy isoflavone, which is found in soy beans and soy products. However other plants produce this compounds too. Red clover is another commonly found herb in herbal products.

As a side note: There are three forms of estrogen in the human body that are commonly talked about. Estradiol is the strongest. The type of estrogen used in modern-day hormone therapy is estradiol. So when you see estradiol in the rest of the article, feel free to mentally substitute “estrogen”.

Is it possible that phytoestrogens can feminize?

All things are possible.

First, let’s talk about dose. Phytoestrogens are found in very small doses in foods, or in slightly higher doses in supplements.

Medical transition requires high doses of hormones. A typical dose of estrogen today, when combined with an anti-androgen is around 4mg a day. Before antiandrogens were introduced, doses equivalent to 12mg of estradiol a day were used*. That’s a lot of hormone.

Phytoestrogen products do not come with an anti-androgen. Is it possible that they’re reaching the equivalent dose of 12mg of estradiol a day? Doses found in Canadian products ranged from 1mg to 35mg of phytoestrogens. So if phytoestrogens are equal in strength to estradiol, perhaps.

But that’s a big assumption. The body absorbs different drugs from the digestive tract in different amounts. Then that drug goes through the liver, where some portion may be activated or deactivated. And then it has to circulate around in the blood stream, find its way into the tissues of the body, and find its target. Pharmaceutical drugs have all these factors measured and calculated, so that the dose you’re given should ensure a certain dose is delivered into your tissues in the end. These herbs have not been studied in that way — so until more research is done, it’s difficult to know how much actually gets to the tissues. And it’s known that phytoestrogens bind to estrogen receptors only weakly, so they’re likely to have a weaker effect than estradiol.

In the doses that are being taken, do they have any effect?

As far as I can tell from the evidence, no. Phytoestrogens are marketed to cis women for relief from hot flashes. A study from 2003 published in JAMA found that they do not provide significant relief from hot flashes. Most of the clinical evidence that I’ve seen agrees with that study.

In cis men, phytoestrogens do not affect testosterone levels and does not feminize.

Worse, one study found that among cis women, those who were taking phytoestrogens had lower levels of estrogen in their blood than women who were not taking phytoestrogens.

While in theory phytoestrogens may possibly help with feminization, I see no medical evidence to suggest that they actually do.

Do phytoestrogens provide a consistent dose? Do the pills contain what they say they contain? Is there any regulation?

No. The dose ranges from company to company, pill to pill, season to season. Companies all have their own special formulations with different sources and types of phytoestrogens.

In the United States, supplements are not regulated by the FDA like drugs are. They’re in a special category. There are no independent checks to make sure the supplement is safe before it goes to market. There are no guarantees that the bottle actually has what it says it has. A Canadian study found wide variation in the amounts of phytoestrogens in various products.

Summary

Phytoestrogen supplements may seem to offer an accessible, easy way to feminize. However, there’s little to no evidence behind their use. And since they’re supplements, you’re never sure of what you’ll be getting. If you want to eat foods that are high in phytoestrogen, they’re not likely to do you harm. But from what I can tell of the literature, you’re better off saving that $20 to pay for an estrogen prescription.

If you’re having difficulty finding a physician who’s will prescribe hormone therapy, I urge you to call your local transgender or LGBT center, or visit the WPATH or GLMA website for provider listings.

*: These formulations were often from conjugated estrogens, which use a slightly different dosing. Doses of conjugated estrogens ranged from 7.5 to 10mg/day, and .625mg of conjugated estrogens is roughly equivalent to 1mg of oral estradiol. My figure of 12 mg of estrogen was using the “low” dosage of 7.5mg.

Jan 042015
 

8787343055_a2a6eb06bf_mIt’s a new year here at Open Minded Health. I hope you all had a safe, fabulous, and fun new years celebration. Here at OMH it’s time for the yearly questions and answers post.

For the unfamiliar — once a year I take a deep look at all the search queries that bring people here. Often, they’re questions that I didn’t completely answer or that need answering. So in case anyone else has these questions — there are answers here now that Google can find. The questions are anonymous and I reword them to further anonymize them.

This year is all questions about transgender health issues. There’s been a lot published and a lot in the news about trans health issues lately. This next year I’ll try to find other articles to post about too, though. 🙂

Questions!

What are the healthier estrogens that a transgender woman can take?

In order from least risk to most risk: estrogen patch, estrogen injection sublingual/oral estradiol, oral ethinyl estradiol, oral premarin.

But note that that’s an incomplete picture. The estrogen patch isn’t the best for initial transition and is very expensive. Injectable estrogen means sticking yourself with a needle every 1-2 weeks and needing a special letter to fly with medications. By far the cheapest of these options is oral estradiol.

Ethinyl estradiol is the form of estrogen used in birth control. Premarin is conjugated equine estrogens, meaning they’re the estrogens from a pregnant horse. Neither should be the first choice for transition. They’re both higher risk than estradiol.

For transgender women, how long does it take to see the benefits of taking spironolactone?

The rule of thumb is 3 months before changes on hormone therapy.

Where is the incision placed in an orchiectomy for transgender women?

That depends on the surgeon. But I’m know you can find images and personal stories on /r/transhealth and transbucket.

Does a trans man have to stop taking hormones to give birth?

Yes. Trans men and others who can become pregnant who are taking testosterone must stop testosterone treatment before becoming pregnant. Testosterone can cross the placenta and cause serious problems for the fetus. Once the child is delivered and no longer breast feeding testosterone can be resumed.

Once you’re on female hormones, how long does it take to get hair down to your shoulders?

My understanding is that the speed that hair grows doesn’t change. It grows at roughly 1/2 an inch a month. Expect growing it out to shoulder length to take 2-3 years.

As a trans woman on estrogen, are there foods I should avoid?

If you’re on estrogen only, there are no foods you should avoid. Instead eat a healthy varied diet.

If you’re on spironolactone you may need to avoid foods that are high in potassium. Potato skins, sweet potatoes, bananas, and sports supplements are foods you may need to limit or avoid. Ask your physician if you need to avoid these foods.

Is there a special diet that can help me transition?

In general, no. Any effect that food may have is, in general, too subtle to make a difference. The possible exception is foods that are very high in phytoestrogens — like soy. Phytoestrogens are chemicals in plants that act a little like estrogen in the body. There are a few case reports in the medical literature of people developing breasts when they eat a lot (and I do mean a lot) of soy. But they’re unusual. Ask your physician before you make radical changes in your diet. In general — just eat a healthy, varied diet.

I’m a trans guy taking testosterone and having shortness of breath. Do I need to worry?

See a physician as soon as you can. Shortness of breath may be a sign of something serious. Taking testosterone raises your risk for polycythemia (too many red blood cells in the blood), which can manifest as shortness of breath.

How often do trans women get injections of estrogen?

Most women have their injection every week to two weeks.

Can I still masturbate while I’m on estrogen?

Yes. Many trans women have difficulty getting or maintaining an erection though.

Can I get a vaginoplasty before coming out as transgender or transitioning?

Generally speaking, no. Surgeons follow the WPATH standards of care which require hormone therapy and letters of recommendation from physicians and therapists before vaginoplasty.

Are there risks to having deep penetrative sex if you’re a trans woman?

I’m assuming you’re referring to vaginal sex post-vaginoplasty. The vagina after a vaginoplasty is not as stretchy or as sturdy as most cis vaginas. It’s possible to cause some tearing if the sex is vigorous or if there are sharp edges (e.g., a piercing or rough fingernails).

Things you can do that might help prevent injury: Make sure you’re well healed after surgery. Dilate regularly as recommended by your surgeon. Use lots of lubrication, and try to go gently at first. Topical estrogen creams may also be helpful for lubrication and flexibility.

Is it safe to be on trans hormone therapy if you have a high red blood count?

Depends. If you’re a trans man looking for testosterone, you may need treatment first to control the high red blood cell count. Testosterone encourages the body to make more red blood cells, which would make the problem worse.

What kinds of injection-free hormone therapy are available to trans men?

Topical testosterone is available for trans men. It’s a slower transition and it’s expensive, but it exists and it works. Oral testosterone should never be used because of the risk of liver damage.

What can cause cloudy vision in trans women on hormone therapy?

Seek medical care. It could be unrelated, but changes to vision are not a good sign.

~~

And that’s it for this year! Next week we’ll be back to normal posts. 🙂