Nov 022015

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 262015

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published! This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

Oct 052015

480px-RGB_LED_Rainbow_from_7th_symmetry_cylindrical_gratingI’ve been saying for years now that the phrase “LGBT community” is insufficient when it comes to health. It’s not one community — it is multiple communities. The social issues and health issues that a gay transgender man faces every day are different from the issues a bisexual cisgender woman faces every day. There are some similarities and grouping the communities together has been politically useful. But it should never be forgotten that L, G, B, and T all face different types of health concerns and have different civil rights battles to face.

A study came out in August that has to be one of my favorites this year. Researchers in Georgia surveyed over three thousand lesbian, gay, bisexual, pansexual, transgender, gender non-conforming, and queer people. They asked about health behaviors of all kinds. And then they did statistical analysis, comparing the various genders (cis male, cis female, trans male, trans female, genderqueer) and sexual orientations (lesbian, gay, bisexual, pansexual, queer, straight). Let’s look at what they found!

  • Diet and exercise: The researchers asked about fatty foods, eating while not hungry, quantity of vegetables and fruits eaten, and about hours and types of exercise. Transgender women had the least healthy diet of all genders. As a group, they were less likely to eat many fruits and vegetables, and more likely to drink sugared drinks and eat when they weren’t hungry. Both cisgender and transgender men were also less likely to eat many vegetables compared with other groups. Genderqueer people and gay cisgender men were most likely to exercise.
  • Substance use: The researchers asked about smoking tobacco and alcohol consumption. Cisgender men were the most likely to drink alcohol, binge drink, and to drink even when they didn’t want to. Participants who identified as queer were also more likely to drink. When it came to tobacco, transgender men and straight participants were the most likely to smoke.
  • Motor vehicle risk: The researchers asked about seatbelt use, speeding, and texting while driving. No clear differences for speeding were noted. Transgender men and straight participants were most likely to drive without a seatbelt. Texting while driving varied considerably; gay and lesbian drivers were most likely to text while driving.
  • Sexual behaviors: The researchers asked about frequency of unprotected sex and sex while intoxicated. Gay men were least likely to have unprotected sex while lesbian women were most likely to have unprotected sex. When it came to sex while intoxicated, only the bisexual participants stood out as being most likely among the groups to have sex while intoxicated.
  • Violence: The researchers asked about self harm and expressing anger at others. Overall rates of interpersonal anger were very low. Transgender men and pansexual people were most likely to self harm.
  • Medical risk taking: The researchers asked about delaying medical care and not following physician advice. Transgender women were least likely to seek care; 1/3 reported that they regularly delayed seeking medical care. Both transgender women and transgender men were more likely to not follow medical advice when it was given. Bisexual people were also more likely to delay seeking medical care compared to lesbian and gay participants.

That’s a mouthful, right? There are a lot of details I left out of this summary and it still threatens to be overwhelming with detail. So how we can break this down even more simply? By talking about the conclusions.

The researchers go into some possible causes for all these different results. Maybe gay men are safer about sex because of HIV risk. Maybe transgender men eat few vegetables because of cultural expectations that “men eat lots of meat and not many vegetables.” Maybe gay and lesbian people text more while driving because of the lack of community-specific messages.

Maybe. And they’re all good thoughts.

I tend to look forward more to what we can do with these data. I’m pretty happy with this study — it’s one of the broadest I’ve seen for inclusion. Few health-oriented pieces of research include pansexual and genderqueer individuals.

It’s important to remember that these results are at the group level. Any individual person who is a gender/sexual minority will have their own health behaviors and risks. They should be evaluated and treated as individuals. From a public health perspective though, this research brings valuable data. Only by knowing what each group faces can prevention, screening, and treatment campaigns be created. Only by knowing, for example, that transgender and bisexual people avoid seeking medical care can we then examine “why?” and act to remove the barriers so that appropriate, respectful medical care is available.

So — can we change the conversation? Instead of talking about “the LGBT community”, let’s talk about “the LGBT communities”. Or, even better, “gender and sexual minority communities” — removing the alphabet soup and expanding the definitions at the same time. This research is only the tip of the iceberg. We have so much more to explore.

The paper is published online ahead of print. The abstract is publicly available.

Aug 152013

Rope (often used in BDSM ) smiley face - CC BY 3.0 Rose Lovell

A new psychological study of BDSM practitioners has just been published. This is the first such research to specifically examine the “Big Five” personality characteristics.

For those of you not interested in the nitty-gritty, here’s the digest: As a group, people who practice BDSM report a better sense of well-being and are more open to new experiences, extraverted, conscientious, and less sensitive to rejection than people who don’t practice BDSM. As with all correlations, this does not mean that BDSM activities caused these differences. Rather, people with these characteristics may be more likely to investigate BDSM.

Are you interested in the details? Cool! Let’s break this study down then.

First, some basics on BDSM. As some readers may remember, BDSM is an acronym standing for: Bondage, Dominance/Submission, SadoMasochism… and probably a few others besides. BDSM is considered an “alternative” sexuality and is highly stigmatized here in the United States. BDSM is often misrepresented as a purely sexual practice focused on pain. In truth, it’s often more sensual than sexual or painful. Many forms of BDSM “play” involve no sex or pain at all. Specific practices vary a lot depending on the people involved**.

Within BDSM, a person is typically in one of three roles: dominant (dom/domme), submissive (sub), or switch. The terms are fairly self explanatory. Dominant “has” control, submissive “gives” control, a switch is someone who switches roles*. Sometimes being a dom/sub/switch is referred to as an orientation, sometimes it’s a role for a particular activity (“scene”)***.

What about these personality characteristics? In personality psychology, there’s the concept of the “big five” personality characteristics, OCEAN: Openness, Conscientiousness, Extraversion, Agreeableness, and Neuroticism. Personality characteristics are thought to be innate. You’re born with a certain personality, and it’s relatively unchangeable. Each of the “big five” can be thought of as a line, and each person falls somewhere along that line. To wit….

  • Openness: How open to new experiences are you? Open vs cautious
  • Conscientiousness: How tidy, thorough and responsible are you? Organized vs careless
  • Extraversion: How much do you enjoy being around other people? Extravert vs introvert
  • Agreeableness: How trusting and cooperative are you? Friendly vs cold
  • Neuroticism: How easily do things tip you emotionally off balance? Easily upset vs steady

Some of these traits are associated with greater happiness and resiliency (e.g., Openness, Agreeableness and Extraversion) whereas others are associated with mental instability or illness (e.g., Neuroticism). There are nuances, overlaps, and arguments over these concepts that I won’t address here, but I hope that gives you a good starting place for understanding the study results. Let me know in the comments if it doesn’t and I’ll gladly expand. This study looked at more than just the “big five”. It also included measures of rejection sensitivity, attachment style, and subjective well being.

So why look at the “big five” and all those others in the context of BDSM? The arguments of the researchers make some sense. While BDSM and the “big five” have not been directly compared before, there is some evidence that the “big five” is associated with certain sexual attitudes. The more open you are, the more permissive your attitudes around sex. The more neurotic you are, the less stable your relationships, thus impacting your sexual life. And so on. Similarly, people with secure attachment styles are more likely to have a wide variety of sexual behaviors and better trust with partner(s) than people with insecure attachment styles.

So we have our variables: the “big five”, rejection sensitivity, attachment style, subjective well-being. What about our participants?

BDSM participants were 902 Dutch people, 464 male and 438 female (no mention of trans or genderqueer folks), recruited from one Dutch BDSM forum. Control participants were 434 Dutch people screened for BDSM behavior, 129 male and 305 female, recruited from magazine ads or websites having to do with “secrets”. Men in the study were older than women. I’m really not sure this control is an adequate control for this study because of the recruitment methods… but I’m not sure it’s not either. Differences between the groups? There certainly were some other than the practice of BDSM. There were significantly more women in the control group than the BDSM group. The control group was younger and less well educated than the BDSM group, although both were more well educated than the average Dutch citizen. Whether these differences affected the study results is unknown, but a possibility.

The researchers also note a gender difference between roles in the BDSM group. Men were 33.4% submissive, 18.3% switch, and 48.3% dominant identified. Women, on the other hand, were 75.6% submissive, 16.4% switch, and 8% dominant. This is certainly reflected in the stereotypes associated with BDSM activities.

Results included:

  • People who practice BDSM were more Open, Extraverted, and Conscientious than the control participants.
  • People who practice BDSM were less Neurotic and Agreeable than the control participants
  • People who practice BDSM were less sensitive to rejection than people who didn’t practice BDSM. Within the BDSM participants, submissives were more sensitive to rejection than dominants
  • People who practice BDSM had a greater sense of well-being than control participants. Dominants scored the highest on well-being.
  • Relatively few differences between BDSM participants and control participants was found when attachment styles were examined. When there was a difference, BDSM participants had a more secure attachment than control participants.

Effect sizes were small to medium. That is about average for a psychological study.

The OCEAN results make sense within the context of BDSM. In order to even try BDSM activities, you’d need to be open to new experiences. Conscientiousness is also valued, in order to be safe. Extraversion is helpful within a community setting. The rejection sensitivity results also make sense to me – a timid person may not continue to explore BDSM after one or two rejections. But this is all after-the-fact reasoning, and not particularly predictive or scientific.

The authors note that these results contradict the long-standing assumption that women who participate in BDSM so do because they were abused as children. But they didn’t ask directly about childhood sexual abuse. Rather, they draw this conclusion from the established relationship between attachment styles and abuse history. Childhood abuse is associated with insecure attachment. But in this study, BDSM folk were more likely to have a secure attachment than the control group. I think this logic is fairly sound, though a definitive answer will need to wait for a study where childhood abuse is specifically asked about.

The most obvious limitations to this study are the participants. The BDSM and control participants were not necessarily comparable, and there were significant known differences between the groups. Those differences could have affected the study’s results. Also, as usual, this study’s results may not be generalizable to BDSM communities in other countries (e.g., the United States).

Despite the limitations, these results are a delightful breath of fresh air, when so much of the literature treats BDSM as psychopathology. People who practice BDSM has long argued that there is nothing inherently “wrong”, “sick” or “dangerous” about their sexuality. These results absolutely support their assertion. The study authors state “We therefore conclude that these results favor the view […] that BDSM may be thought of as a recreational leisure, rather than the expression of psychopathological processes.” Yes, yes and yes.

The study was published in the Journal of Sexual Medicine. The abstract is publicly available.

* This is a highly simplified description. Power, and the exchange of power, is complex.

** It’s important to note, though, that for many people who participate in BDSM pain is very important, if not the central experience.

*** In addition to Dom/Sub/Switch, there’s also the idea of “topping” and “bottoming”. Topping and bottoming are much more transitory than Dom/Sub/Switch. In any particular activity, the Top is the “do-er” and the Bottom is the “do-ee”. But being Top or Bottom is activity specific and not as much of an orientation as Dom/Sub/Switch.

May 012013

One way to reduce stress and cortisol - CC BY 2.0 - flickr user eamoncurry123Summary: Research now indicates that cross-sex hormone therapy is associated with a lower cortisol awakening response in trans people, regardless of attachment style. Many confounding variables, however, were present in this study.

Transgender people have long asserted that gender dysphoria can be extremely distressing and that transition, including hormone therapy, helps relieve that dysphoria. Hormone therapy is known to improve self-reported quality of life, as measured by questionnaire. To my knowledge no other study has looked at stress-related biological factors in trans people. Biological factors are important because self-report is notorious for validity problems. This study looked at one such biological factor, called the cortisol awakening response.

What is the cortisol awakening response? Readers of the blog may remember the last time I spoke about cortisol (paragraph #2). For those who don’t remember…. cortisol is a “stress hormone.” When we’re stressed, whether by speaking in public or running from a lion, cortisol is released. It helps our body be ready for immediate survival by increasing blood sugar and helping with metabolism. High cortisol levels over a long period of time can have many negative effects on health, including weakening the immune system. The cortisol awakening response is part of the daily cycle, when blood levels spike about 20-30 minutes after waking in the morning. The cortisol awakening response is larger in stressed people than in non-stressed people and can be affected by many things, including burn out, fatigue, aspirin, and sleep schedule. Awakening response is thought to be a good indicator of general stress levels and as a good indicator for stress-related disease risks. In case you start suffering from insomnia take a look at the best CBD oil for sleep with no side effects that can reduce the risking your health.

Participants in this study were 70 trans people seen at the Gender Identity Unit of the University of Bari Psychiatric Department, roughly 64% trans women. All the participants had the same hormonal treatment; transdermal estradiol gel and cyproterone acetate (an anti-androgen) for trans women, intramuscular testosterone esters for trans men. They were assessed before hormone therapy and 12 months after starting hormone therapy. There was no significant difference in age, education, or occupation between the two groups.

The researchers measured perceived stress (a self-report of how stressed a person feels) in addition to the cortisol awakening response. The cortisol awakening response was measured by a blood test at 8:00am on three consecutive days, 1 hour after waking.

The results were striking. Before treatment, both perceived stress and cortisol levels were above the  “normal” range. After twelve months of hormone therapy, both were much lower and back within normal ranges. There were no statistically significant differences between trans men and trans women.

However there are a number of confounds for this study. Cortisol levels vary with sex hormones. For example, the cortisol levels of menstrual women will vary depending on which part of the menstrual cycle they’re in. Could cross-sex hormone therapy have caused this change in cortisol levels? Maybe, but then I’d expect there to be a difference between the trans men and trans women in this study and there weren’t.

The researchers also did not appear to attempt to control for other factors which could have impacted the cortisol awakening response. Changes in sleep patterns (e.g., naps) or sleep quality (e.g., a noisy environment) have effects on the cortisol awakening response. As far as I can tell the researchers did not screen for these changes.

Cortisol and stress were not the only things measured in this study. The researchers also looked at attachment styles. Attachment styles are a psychological concept. The idea is that when we are children our interactions with parents, and how they respond to our needs, affects the type of “attachment” we have. Attachment styles are secure or insecure. A secure attachment often results in happy adult relationships. Insecure attachments include avoidant, anxious, and unresolved/disorganized styles. Attachment styles may influence how we respond to stress, so they could have been a confound in this study if not examined.

The researchers determined the attachment style of the participants with a structured interview. They found that trans people are more likely to have an insecure attachment (70%) than the general population with no psychiatric diagnoses (44%). Attachment style did not, however, appear to be correlated with cortisol awakening response or perceived stress.

In other words, the relationship trans people have with their parents did not appear to affect the stress-reducing effects of hormone therapy.

I do not really understand why these researchers chose to examine attachment style in this study. I think that knowing attachment styles may be useful for therapy or for the development of effective variations on therapies for trans people. But I don’t feel that the inclusion of attachment style was sufficiently justified in this study. Why look at attachment and not, for example, socioeconomic status or social support? I would think either of those would be more likely to have an impact on stress levels than attachment.

On the whole: I think that the cortisol results of this study are decent validation of the anecdotal evidence from trans people themselves, but that the exploration of attachment style in this context is a red herring.

The abstract is publicly available.