Nov 022015
 

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 262015
 

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published! This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

Jun 032014
 

6763959_10420a4b6a_mThe biggest news for May of 2014 is really that Medicare lifted the blanket ban on covering genital surgeries for trans people. The National Center for Transgender Equality has a good summary (PDF) of what the decision actually means. If you’re trans and interested in surgery and are a Medicare recipient, I recommend calling the physician who’s prescribing your hormones and consulting with them about next steps. The news was covered in multiple outlets including the NY Times and CNN.

The other piece of news I spotted that is not getting as much traction as I’d like is this: Urine is NOT sterile! For a long time it’s been believed that urine produced by healthy people is sterile – at least until it passes through the urethra. Turns out not to be the case. Something to keep in mind if you have contact with urine. Source

Interested in the other news? Read on!

  • Work continues on the possibility of three-parent babies. While much of the research and reporting talks about preventing mitochondrial diseases, I still think it opens a wonderful door for three-parent poly households. The latest news is fairly political, but supportive.
  • Another study out of Europe indicates that transgender hormone therapy is safe. This was a 1-year study of both men and women, just over 100 people total No deaths or serious adverse reactions were reported. Highly recommend you skim the abstract for yourself! For US readers, please do note though that the hormones used in the study were different formulations than those used in the US. Source.
  • A published case study reminds us that not all “odd” physical things during medical transition are related to transition. This was a case of a trans man who had undiagnosed acromegaly from a benign brain tumor. Eek! He was correctly diagnosed and treated, thankfully. Source.
  • A Swedish review of transgender-related records found a transition regret rate of 2.2%. Other prevalence data, including the usual male:female ratios, are included. Source.
  • A study of gay men found that they have worse outcomes from prostate cancer treatments than straight men. Source.
Apr 012014
 

CC - see linked URLBeen a busy month here. First, let’s have the news!

Transgender

  • A study has failed to find support for the theory that transgender people can be separated into different typologies based on sexual orientation. Source.
  • Gender dysphoria has been found to be correlated with autism/asperger’s and attention deficit disorder. Source.
  • Among trans people seeking care in the emergency department, 52% have at least one negative experience. 32% heard insulting language and 31% were told their provider didn’t know how to provide care. These statistics were gathered in London, Ontario. Source
  • Cross-sex hormones change cortical thickness in the brain. Source.
  • A meta analysis found that the type and dose of estrogen does not impact breast size for trans women. They also did not find an effect, positive or negative, for progestins. Source.
  • A panel lead by a former U.S. surgeon general has urged the US military to eliminate its ban on transgender service members. Source.

Sexuality

  • Pap smears may soon be replaced by HPV-only testing. Source.
  • 43% of young adult and teenaged men report having experienced sexual coercion. 95% of those were initiated by a woman. 18% of those incidents were physical force, 31% verbal, 26% via seduction, and 7% via drugs/alcohol. Tell me again how sexual violence is a woman’s problem. Source.
  • Shout Out Health posted their reminder of how you can find a gay-friendly health care provider

~~

On an administrative note, I’ll be attending a medical school in Connecticut come the Fall. I don’t know yet what that’ll mean for post frequency here at Open Minded Health, but be warned that things may shake up a little bit.

As always…  Stay healthy, stay safe, and have fun!

Oct 112013
 
fMRI image from the study

fMRI image from the study

This study was a two-part study. They compared trans and cis participants while viewing erotic vs nonerotic videos and then responding to questionnaires. They also did fMRI brain scans on the participants. Researchers concluded that trans participants had a stronger anterior cingulate cortex to ventral tegmental area connection than cis participants. However, this study was problematic, as you’ll see further down, and I do not think its results can be taken without a very large grain of salt.

Unusual among trans studies, this study came out of China. 41 trans folk were recruited for the study, 21 trans men and 20 trans women. Trans people both on hormones and not on hormones were included, but no participants had had surgery. All trans participants were recruited from a psychiatric clinic. The control group was 38 heterosexuals recruited from the internet, equally split between sexes. For the brain scan study, only trans participants who were not on hormone therapy were involved to reduce the possible variable of sex hormones. Participants were screened for pregnancy, ovulation, a history of sexual abuse, consumption of certain substances or within 24 hours of the study (alcohol, caffeine).

Participants were also screened for their sexual orientation. The control group was only “heterosexual”, the trans group mostly “homosexual”. Why the quotes? Well in truth, their categorizations ignored bisexuals. The way they coded participants, a cis person who preferred (but not exclusively preferred) the same sex to the opposite sex would be classified as “homosexual”. The authors do not clarify what they mean by a “homosexual” trans person. Historically, the label “homosexual” in reference to trans people refers to their sex, not their gender. It’s considered offensive to use that terminology today. A trans woman who was attracted to men would be considered homosexual. Because the authors didn’t define “homosexual” in the context of trans people, I have no idea what they actually meant. I can only assume they meant that old, disrespectful meaning. That is, that all the trans women in this study were attracted to men and all the trans men in this study were attracted to women.

Participants watched 8 short films: 4 heterosexual erotic films and 4 heterosexual non-erotic films. After watching the films, they were asked to rate how aroused they were after the film and asked how much they identified as male/female during the film. Participants also filled out other questionnaires including:

  • Questions assessing how much the participant identified as the opposite sex, and how much the participant desired to be the opposite sex
  • the Beck Depression Inventory, a well-established measure of depression and suicidality
  • the Defense Style Questionnaire, an assessment of which Freudian defense mechanism one uses
  • the Klein Sexual Orientation Grid, as described above.

Results for this part of the study? Well, all participants were aroused by the erotic films. All groups identified statistically significantly more with their gender than their sex for all films. No difference was found between trans people on or not on hormones. As for the questionnaires…? Well the authors don’t actually talk about them in the results section – you have to go back up to demographics to find it…. And no surprise, trans people were significantly more likely to identify as the opposite sex, desire to be the opposite sex, and have more depression symptoms than their cis counterparts. Trans people were also significantly more likely to use the defense strategies of “undoing“, “altruism“, and “displacement“.

But what about the brain scans? Let’s look at those next… A subgroup of control participants, and all the trans participants who were not on hormones, participated in this part. fMRI was used while participants rests, staring at a specific point on a wall. fMRI is a technique which images changes in blood flow in the brain.

The researchers examined the connection between two specific areas of the brain: the ventral tegmental area and the anterior cingulate cortex. Why those parts? I’ll let the researchers speak for themselves. They describe the anterior cingulate cortex as “a neural structure central to the consciousness of self and conflict monitoring as well as social processing”. They describe the ventral tegmental area as “a neural substrate that is involved in dimorphic genital representation and the rewarding value of sexual behaviors.”

From what I can tell, from my memories of my neuroscience class, my neuroscience textbook, and the internets, I think they’re overstating the known roles of those brain areas. The anterior cingulate cortex does seem to have a role in detecting errors and cognitive and emotional self-regulation. However, it’s a far cry from that to declaring that it’s “central to the consciousness of self.” I have no idea what the authors mean by the ventral tegmental area being involved in “dimorphic genital representation”, since their citations have nothing to do with that. Their citations for that claim are two papers showing that blood flow increases in the ventral tegmental area during both cis male and cis female orgasm. That’s not exactly a surprise – the ventral tegmental area has to do with reward processing and is known to be involved in addiction. But “dimorphic genital representation”? Not a clue. That phrase doesn’t seem to exist anywhere outside their paper.

The authors state that they found more connectivity between the ventral tegmental area and the anterior cingulate cortex in their trans participants than in their control group. I don’t have enough background in interpreting fMRIs to evaluate that claim. If someone out there reading this does, your input would be welcome!

The authors do not discuss their results. The only “discussion” I found was in their abstract, where they conclude: “The neural connectivity pattern suggests a brain signature of the psychosocial distress for the gender-sex incongruity of [trans people]”. …maybe? But that sounds like a big assumption to me. There are just too many variables for that conclusion to be reasonable. An enhanced connection between the anterior cingulate cortex and the ventral tegmental area could easily be explained as a general reaction to psychosocial stress, not necessarily gender dysphoria. In fact, that appears to be a more reasonable hypothesis, given some recent studies which I found on a quick trip through Google.

I find this study highly problematic. I do not think their conclusions are supported by the data they present. Nor do I think their methods were sound, nor their participant selection. Specific problem areas I saw in addition to the ones I already mentioned include:

  • The study is insufficiently justified. Why exactly was it done?
  • The methods are insufficiently justified. My first thought when I saw it involved erotic vs nonerotic videos was that the researchers were conflating sexual orientation and gender identity (again). I don’t see anything in the paper that dissuades me from that first impression.
  • Participants were pulled from completely different pools. All trans participants were from a psychiatric clinic and all cis participants from an online forum. They are not comparable! And I have some serious ethical concerns with using trans participants specifically from a psychiatric clinic. There may have been subtle psychological and sociological forces at work which induced them to participate, despite the reassurances of the researchers that participation would not affect their treatment (hormones). It reminds me of an old study of Blanchard’s from the 1980’s where cross-dressers in a psych unit who were not financially compensated were compared to a control group who was not in a psych unit and who were financially compensated.
  • The Defense Style Questionnaire sounds very Freudian to me. Considering that the vast majority of Freud’s theories are not considered scientific (being unmeasurable), its inclusion seems fishy to me.
  • Trans participants were statistically significantly more likely to have more depressions symptoms on the Beck Depression Inventory, yet the authors did not consider this in their conclusions. It seems to me to be a huge confound. It would be much better to compare trans participants with a cis group with a similar score.

In summary, I do not think this study adds very much to our knowledge of trans brains. But I very much would like to hear what everyone else thinks of this study. Does it make sense to you? Did I miss something you see? Please do let me know! 🙂

This paper is publicly available in its entirety at PLOS ONE.