Nov 162015

This week let’s take a break from genetics and ask: “Among transgender people seeking medical treatment, how many want what treatment? Among those who are not seeking out the traditional transition, what are their reasons?” As you might have guessed, a paper from the Netherlands was just online published ahead of print addressing these very questions.

360 people seeking treatment at a specific clinic in the Netherlands were surveyed; 233 (64.7%) of them were assigned male at birth (AMAB; mostly trans feminine) and 127 (35.3%) were assigned female at birth (AFAB; mostly trans masculine). Because this was a survey specifically asking about trans people who may fall outside the gender binary, I’ll stick to the AFAB/AMAB terminology.

The researchers also defined “full” and “partial” transition. For the purposes of this study, “full” transition was either:

  • Antiandrogens + estrogen + orchiectomy + vaginoplasty, for AMAB people
  • Androgens + mastectomy + hysterectomy/oophorectomy + phalloplasty or metoidioplasty, for AFAB people

Variations on these were considered “partial” transition, even if they included more surgeries (such as facial feminization surgery or breast augmentation). By using the terms “full” and “partial”, neither the researchers nor I are trying to imply that one form of transition is any better, desirable, or more “complete” than any other. It’s a historical term, and used here only as a label for one set of treatments that have been considered a “standard” treatment.

So — what did the 360 people want? 10 weren’t sure yet (2.8%). Overall, 253 (70%) wanted “full” treatment. and 97 (27%) wanted “partial” treatment. Of the 97 who wanted a “partial” treatment, 47 cited surgical risks and concerns about the ultimate result, 19 had no genital dysphoria and felt genital surgery wasn’t important for them, 5 felt they were too old, 4 had a non-binary gender identity, 1 was afraid of social rejection, 1 wanted to remain fertile, 1 wanted to go outside the country for surgery, and the others declined to answer.

If you look at the data differently, AFAB and AMAB people wanted different things. Among the 225 AMAB people who knew what they wanted, 180 (77%) wanted “full” treatment. Only 45 (19%) wanted a different treatment. 12 wanted hormones only, another 12 wanted hormones and breast augmentation, and another 10 wanted hormones and breast augmentation and facial feminization surgery.

AFAB people were less likely to want “full” treatment — only 73 of 125 (57%) wanted “full” treatment. Of those, 35 wanted phalloplasty, 12 wanted metoidioplasty, and 26 were uncertain. 52 of 125 (41%) wanted “partial” treatment, with the majority (31) wanting androgens, mastectomy and hysterectomy and 18 wanting androgens and mastectomy without hysterectomy.

That’s quite a difference between AMAB and AFAB people — 77% vs 57% wanting “full” treatment. When the reasons were compared, AFAB people were most likely to be concerned about the risks and results of surgery. AMAB people, on the other hands, were more likely to report feeling that genital surgery was unnecessary.

Of course, this was just one survey within one culture. However, it’s interesting food for thought and gives one set of ballpark figures for who wants what treatment.

Want to read the study for yourself? The abstract is publicly available!

Nov 022015

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

Last week’s paper looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Oct 262015

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published!

This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

Oct 192015

206px-Polytat.svgIf you were to ask 10 strangers the #1 way to prevent a sexually transmitted infection, what do you think they might answer? Very likely one of their answers will be “monogamy.” And they wouldn’t, strictly speaking, be wrong. The fewer numbers of people you have sexual contact with, the less likely it is you’ll have been exposed to a sexually transmitted disease. This concept gets drilled into high schoolers lucky enough to have a sexual education class: Be abstinent. If you’re not abstinent, at least be monogamous.

But monogamy isn’t for everyone. Some chafe at the practice, strongly preferring to share their love and sexuality with more than one individual. Monogamy is not for them. Instead of relying on monogamy to protect them from disease, they use barriers such as condoms and test themselves and their partners for disease. And they communicate.

Here’s a question though: Does the use of barriers protect as well as monogamy does? I’ve felt it probably does, but haven’t seen any data to say one way or another.

And then this study was published!

This week’s study polled monogamous and (consensual) non-monogamous people and asked them about their sex life, their use of barriers, their STI testing, and so on. They recruited around 550 participants, 70% female, 63% monogamous, 77% heterosexual.

What did they find?

Among the nonmonogamous participants, 72% had sex with a partner other than their primary partner. 37% reported that their primary did not know about this sexual encounter.

Among the monogamous participants, 24% had sex with a partner other than their primary partner. 75% reported that their primary did not know about this sexual encounter.

In other words: both monogamous and nonmonogamous participants, as groups, had sexual encounters with people other than their primary partner. Nonmonogamous people were more likely to have that sex and to tell their partners about it. When monogamous people had sex outside their partnership they were far less likely to tell their partner.

And what about safe sex? Both monogamous and nonmonogamous participants were equally likely to use barriers with their primary partner. However, nonmonogamous participants used barriers with others more often than monogamous participants.

When it came to STIs, there was no difference in actual diagnoses of STIs. But nonmonogamous people were more likely to get tested.

Now — let’s translate all that.

What this ultimately means is that people who practice consensual nonmonogamy are no more likely to get a sexually transmitted infection than are monogamous people. This is very likely because nonmonogamous people use barriers/condoms with other partners and get tested more often.

As the paper stated: “Persons who have made monogamy agreements often break them, and when they do, they are less likely to take safety precautions, get tested for STIs, and disclose those extradyadic encounters to their partners than persons who agree to some form of negotiated nonmonogamy.” Absolutely.

Monogamy is one way to try to prevent the spread of STIs…and it is equally as effective as clear communication and relationship negotiation with the use of barriers and STI testing in non-monogamous relationships.

The study was published in the Journal of Sexual Medicine, and its abstract is publicly available.

Oct 122015
Human Papilloma Virus

Human Papilloma Virus

Little is known about reproductive cancer risks among cisgender lesbian and bisexual women. Cancer registries generally don’t ask about sexual orientation. Studies suggest so far that lesbian and bisexual women are less likely to get a pelvic exam and pap smear when it’s recommended. Pap smears help to detect cancer in its earlier, most easily treated and cured stages. Logically, lesbian and bisexual women may be at risk for having more developed (and potentially incurable) cancers. The data confirming that aren’t in yet, but it seems likely.

And now we have HPV vaccines. The human papilloma virus is a major cause of cervical cancer, along with anal cancer, penile cancer, and mouth/throat cancers. Human papilloma virus spreads by skin-to-skin sexual contact regardless of biological sex or gender. Along with pap smears, the HPV vaccine has been a great tool for preventing advanced cervical cancers.

This week I looked at a study of survey data from 15-25 year old women from the National Survey of Family Growth, from 2006-2010. They asked the questions: “Have you heard of the HPV vaccine?” and “Have you received the HPV vaccine?”

The results were rather spectacular. Lesbian, bisexual, and straight women had heard of the HPV vaccine. There was no difference there. However, 28% of straight women, 33% of bisexual women and 8.5% of lesbian women received the HPV vaccine.

That’s 8.5% of lesbians vs 28-33% of non-lesbian women.

Why?? Lesbians are at risk for HPV infection too!

Before looking at what the authors thought, I have some thoughts of my own.

2006, the earliest year this study had data on, isn’t too far off from when I graduated high school. I remember the sex ed class we had. We were lucky to have sex ed at all. It was a one-day class focused on the effectiveness of birth control options, how to put a condom on a banana (or maybe it was a cucumber?), and sexually transmitted diseases that can be passed between men and women in penis-in-vagina sex. There was no discussion of sexually transmitted diseases that are passed between men who have sex with men or women who have sex with women. I remember walking out of the class feeling confused and alone — what STDs were passable between women, and how can women protect themselves and their partners? Were there diseases that women could spread? Was protection warranted? I had no idea.

The study authors discuss similar problems and attributed the difference between lesbian HPV vaccine and bisexual/heterosexual HPV vaccine to misinformation. The idea that lesbian women who have never had sexual contact with men don’t need pap smears or HPV vaccines is old and incorrect, but still persists. I remember when pap smears were recommended starting at first sexual contact with men — if a woman never had sexual contact with a man then she didn’t ever need a pap, right? Wrong!

But it takes time to correct misinformation. As the authors correctly point out, important changes have happened since 2010. HPV vaccine is now recommended for all young people regardless of sex, sexual activity, sexual orientation, or gender identity. It’s not just a vaccine for a sexually transmitted disease — it’s a vaccine against some forms of cancer. Pap smears are now recommended for everyone with a cervix every 3-5 years or so.

So can you be part of the change? Help spread the word about HPV vaccine for *all* people, and pap smears for people cervixes!

The study was published in the Annals of Internal Medicine. The abstract is publicly available.